We narrowed to 19,193 results for: REV;
-
Plasmid#140132Purposecan be used to generate AAV virus that will express fusion protein of split Cre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCreV
Plasmid#140131Purposecan be used to generate AAV virus that will express fusion protein of split Cre (N-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertNCreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLTR.gp140/EGFP.Revdelta38/DsRed
Plasmid#115775PurposeHIV splicing reporter allows the assessment of the effect of LRAs on HIV-1 transcription and splicing.DepositorInsertEnvelope fused to EGFP (gp140-EGFP) and non-functional Rev protein fused to DsRed fluorescent protein (Rev-delta38-DsRed).
TagsEGFP; dsReDExpressionMammalianMutationgp140 uncleaved (1190-91aa, KR > TG; truncated…PromoterHIV-1 (LTR)Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbsr-EKARrEV-NLS
Plasmid#173854PurposeA lentiviral vector for EKARrEV-NLSDepositorInsertEKARrEV-NLS
UseLentiviralExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-EKARev(T/A)
Plasmid#118475PurposeNegative-control mutant for RAB-EKARev biosensor.DepositorInsertRAB-EKARev(T/A)
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRevTRE MKL1-N100
Plasmid#19848DepositorAvailable SinceJan. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S2-RAB_EKARev
Plasmid#160726PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter RAB-EKARev (ERK indicator), VSV-G tag, and S2 protein scaffold.DepositorInsertS2-RAB_EKARev
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S3-RAB_EKARev
Plasmid#160727PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter RAB-EKARev (ERK indicator), VSV-G tag, and S3 protein scaffold.DepositorInsertS3-RAB_EKARev
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-AKARev(T/A)
Plasmid#118479PurposeNegative-control mutant for RAB-AKARev biosensor.DepositorInsertRAB-AKARev(T/A)
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CDreV
Plasmid#140133Purposecan be used to generate AAV virus that will express fusion protein of split Dre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCDreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pelB-MBP-RevA-ss
Plasmid#137064PurposeE. coli expression clone (T7lac promoter) for mature RevA (aa 25-160) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavageDepositorInsertAAF07416.1 (revA Borrelia burgdorferi B31)
TagsPelB signal peptide + His10 + maltose binding pro…ExpressionBacterialMutationlacks the RevA signal peptide and 5 residues (CKA…PromoterT7lacAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMB36(revcomp)/Dvl1_1_670
Plasmid#40557DepositorAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHU6_chr12_FAM19A2-up-gRNA-rev
Plasmid#81220PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locusDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_D1b_attB_rev
Plasmid#182152PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-D1b-attB-rev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_C2c_attB_rev
Plasmid#182151PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-C2c-attBrev pegRNA
ExpressionMammalianPromoterhU6Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch13_102010574-gRNA-rev
Plasmid#81219PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch13 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch12_62418577-gRNA-rev
Plasmid#81217PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch12 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pN1_Rev-GR(m10)-EGFP
Plasmid#252751PurposeControl for studying nuclear export. Expression of a fusion protein containing full-length Rev, the hormone-responsive element of the rat Gr, and GFP. The m10 mutation abolishes nuclear export.DepositorInsertHIV-1 Rev and Glucocorticoid Receptor (GR)
TagsEGFPExpressionMammalianMutationm10 is mutation of nuclear export sequenceAvailable SinceMarch 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
Sc rev7-pRS405/GAL
Plasmid#241259PurposeOver-express Sc rev7 (Sc Pol zeta subunit) in yeast (integrated)DepositorInsertrev7 (REV7 Budding Yeast)
ExpressionYeastAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only