-
Plasmid#228410PurposeExpression of NIT-9 with reversed domains in N. crassa at the his-3 locusDepositorInsertNIT-9 domains reversed
UseProtein expression in n. crassaTagsExpressionMutationdomains reorientedPromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCARS1
Plasmid#174868PurposeContains TEF1p-TEF1in-hGFP-CYCt cassette and wildtype ARS1DepositorInsertARS1
UseSynthetic BiologyTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGrDL_SPb
Plasmid#83205Purposereceives miRNA target sequences for testing using the dual luciferase assay systemDepositorInsertTomato ACTIN promoter
UseTagsExpressionPlantMutationPromoterTomato ACTINAvailable sinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGrDL_SP
Plasmid#83204Purposereceives miRNA target sequences for testing using the dual luciferase assay systemDepositorInsertSalI/PstI cloning sites
UseTagsExpressionPlantMutationPromoterAvailable sinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_zeo insert c-MYC
Plasmid#164636PurposesgRNA(MS2)_zeo backbone with cloned target sequence for human c-MYC. The insert sequence is: 5-CACCGTTCCCCCACGCCCTCTGCTT-3´ . This sgRNA achieves an upregulation of MYC in combination with dCAS9-VP64DepositorInserttarget sequence for c-Myc activation (MYC Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 and EF1AAvailable sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
p240 pPr-CREM/Ins
Plasmid#8405PurposeAndrogen-inducible expression of Cre, with chimeric/β-globin intron within the Cre coding sequence and chicken globin insulators.DepositorInsertprobasin driven CREM with insulators
UseCre/LoxTagsExpressionMammalianMutationmodified CrePromoterProbasin promoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pQE80L TriCatcher-RGDSP-MMP
Plasmid#112633PurposeTwo SpyCatchers linked by an elastin-like polypeptide with an RGDSP integrin-binding site, an MMP-cleavable sequence and a C-terminal SnoopCatcherDepositorInsertTriCatcher-RGDSP-MMP
UseTagsHis6 and TEV cleavage siteExpressionBacterialMutationcentral matrix metalloproteinase-cleavable sequen…PromoterT5Available sinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
p236 pPr-CREM
Plasmid#8404PurposeExpression of Cre from tissue-specific, androgen-inducible probasin promoter, with chimeric/β-globin intron within the Cre coding sequence.DepositorInsertprobasin driven CREM
UseCre/LoxTagsExpressionMammalianMutationmodified CrePromoterProbasin promoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLSLZ
Plasmid#51495PurposepLSL with Zif268:FokI coding sequence followed by approximately 3kb 'filler' sequence, Rep is not included on this plasmidDepositorInsertsZif268:FokI
3kb filler sequence
UsePlant t-dna plasmidTagsSV40 NLSExpressionMutationPromotervirion-sense LIR and 2x35SAvailable sinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
p201N 1514
Plasmid#47025PurposeContains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencingDepositorInsertsgma-miR1514 recognition sequence
nptII selectable marker
UseRNAiTagsExpressionMutationPromoterGmUbi and StUbi-3Available sinceAug. 30, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
GB2880
Plasmid#193117PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.6
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3277
Plasmid#193131PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.4
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2888
Plasmid#193126PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.4
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2886
Plasmid#193124PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2883
Plasmid#193120PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.4
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2882
Plasmid#193119PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2878
Plasmid#193115PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2881
Plasmid#193118PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.2
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2887
Plasmid#193125PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.6
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only