We narrowed to 15,952 results for: grna
-
Plasmid#187267PurposeLentiviral expression of shRNA targeting CortactinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLL5.0 hCortKD-Flcortmut3YD EGFP
Plasmid#187264PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsEGFPMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCAV1-NLS-mCherry
Plasmid#187257PurposeLentiviral expression of shRNA targeting Caveolin1 and NLS-mCherryDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBPK1520-HEK3-CTTins-ng
Plasmid#180019PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of HEK3 CTT insertion in PE3 approachDepositorInsertPrime editing ngRNA for HEK3-CTTins (EPHA8 Human)
UseCRISPRExpressionMammalianPromoterHuman U7Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_2
Plasmid#185017PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_FDX1-2
Plasmid#184489PurposeLentivirus all in one CRISPR vector targeting human FDX1 geneDepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_1
Plasmid#185016PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3A
Plasmid#183283PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3A geneDepositorInsertDNMT3A
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP1
Plasmid#183323PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP1 geneDepositorInsertTOP1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PDGFRA
Plasmid#183313PurposeAll-in-One CRISPRko system with a guide RNA that targets PDGFRA geneDepositorInsertPDGFRA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PARP1
Plasmid#183312PurposeAll-in-One CRISPRko system with a guide RNA that targets PARP1 geneDepositorInsertPARP1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH1
Plasmid#183300PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH1 geneDepositorInsertIDH1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only