We narrowed to 3,061 results for: SRS;
-
Plasmid#162341PurposeLentiviral expression of NEUROG3 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only
-
KIF1A(1-393)-GCN4-2xmCherry-EF(C)
Plasmid#61665PurposeTandem mCherry-labeled, forced-dimeric, truncated kinesin-3 fused to EF Hand linkerDepositorInsertKIF1A(1-393)-GCN4-2xmCherry-EF(C) (KIF1A Human)
ExpressionMammalianAvailable SinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EFS-Cas9-P2A-HygR
Plasmid#164134PurposeLentiviral construct for the expression of SpCas9 driven by EFS promoter in mammalian cellsDepositorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-LAR-GECO1.2
Plasmid#61245PurposeExpresses LAR-GECO1.2 in the mitochondria in mammalian cellsDepositorInsertLAR-GECO1.2
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to R-GECO1.2: N45I/A47R/E1…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HcRed
Plasmid#25892PurposeGateway entry vector containing HcRed.DepositorInserthcRed
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-myo1e
Plasmid#249264PurposeFluorescently tagged myosin 1eDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB713B-pCMV-MITD-NeoMini-T2A-tCD19-WPRE
Plasmid#174610PurposePiggyBack transposon expressing a fusion of a tandem minigene antigens in KRAS, BRAF and CMV fused to an endosomal targeting sequence and translationally linked to human truncated CD19DepositorInserthuman CD19, antigen minigene
ExpressionMammalianAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huAsCpf1
Plasmid#90095PurposeBacterial expression plasmid for protein purificationDepositorInserthuAsCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AausFP1
Plasmid#129499PurposeExpresses AausFP1 constitutively in E. coli (most strains)DepositorInsertAausFP1
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p221a-GUS
Plasmid#71263PurposeEntry clone containing the GUS enzyme. Can be used to construct transcriptional reporters. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGateway CloningAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn GAPDH
Plasmid#220918PurposeNeuronal specific expression of GAPDHDepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-ABE8e(V106W)
Plasmid#198556PurposeExpresses human codon-optimized SpCas9-NRCH-ABE8e(V106W) and blasticidin resistance: EFS promoter-SpCas9-NRCH-ABE8e(V106W)-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-ABE8e(V106W)
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-BAIAP2 wt
Plasmid#31675DepositorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CMV-Cas9-P2A-HygR
Plasmid#164133PurposeLentiviral construct for the expression of SpCas9 driven by CMV promoter in mammalian cellsDepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP71-super-IL-2
Plasmid#174599PurposeExpresses extracellular domain of human IL-2 (aa 21-153) (mutant H9 containing the mutations L80F / R81D / L85V / I 86V / I92F) developed by the Garcia LabDepositorInsertextracellular domain of huIL-2 (aa 21-153) (mutant H9 containing the mutations L80F / R81D / L85V / I 86V / I92F)
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BFP
Plasmid#25891PurposeGateway entry vector containing BFP.DepositorInsertBFP
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huLbCpf1
Plasmid#90096PurposeBacterial expression plasmid for protein purificationDepositorInserthuLbCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV site…ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only