We narrowed to 26,046 results for: Nes
-
Plasmid#83478PurposeMammalian expression of the dehydrogenase-deficient mutant DLD-H450A.DepositorAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-BbTagBY (AAV9)
Viral Prep#45185-AAV9PurposeReady-to-use AAV9 particles produced from AAV-EF1a-BbTagBY (#45185). In addition to the viral particles, you will also receive purified AAV-EF1a-BbTagBY plasmid DNA. Brainbow construct encoding farnesylated TagBFP and EYFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsTagBFP, EYFP, or none.Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-tdTomato-WPRE (AAV5)
Viral Prep#51506-AAV5PurposeReady-to-use AAV5 particles produced from AAV phSyn1(S)-tdTomato-WPRE (#51506). In addition to the viral particles, you will also receive purified AAV phSyn1(S)-tdTomato-WPRE plasmid DNA. hSyn-driven tdTomato expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterphSyn1TagstdTomatoAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV1)
Viral Prep#51502-AAV1PurposeReady-to-use AAV1 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV5)
Viral Prep#51502-AAV5PurposeReady-to-use AAV5 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceOct. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV9)
Viral Prep#51502-AAV9PurposeReady-to-use AAV9 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV8)
Viral Prep#51502-AAV8PurposeReady-to-use AAV8 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre-dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV2)
Viral Prep#51502-AAV2PurposeReady-to-use AAV2 particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre dependent EGFP expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE (AAV1)
Viral Prep#51509-AAV1PurposeReady-to-use AAV1 particles produced from AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE (#51509). In addition to the viral particles, you will also receive purified AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE plasmid DNA. hSyn-driven, Cre-dependent expression of cytoplasmic tdTomato and presynaptic EGFP (synaptophysin-fused). These AAV preparations are suitable purity for injection into animals.DepositorPromoterphSyn1TagstdTomato (cytoplasmic, Cre-dependent), EGFP (presynaptic, C…Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-EGFP-WPRE (AAV Retrograde)
Viral Prep#51502-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV pCAG-FLEX-EGFP-WPRE (#51502). In addition to the viral particles, you will also receive purified AAV pCAG-FLEX-EGFP-WPRE plasmid DNA. CAG-driven, Cre-dependent EGFP expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmax-3xFLAG_3xNLS_dPspCas13b(AAAA)_2xNLS-Clover
Plasmid#196829PurposeExpress dpdpCas13b with AAAA mutation and CloverDepositorInsertdpspCas13b(AAAA)
Tags3XFLAG and NESExpressionMammalianMutationK367A, D369A and K370AAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSC-5
Plasmid#62889PurposeLenti vector for expression of inducible split Cas9DepositorInsertsSpCas9(574-1368)
SpCas9(2-573)
UseCRISPR and LentiviralTagsFFBP12, FRB, NES PTK2, NLS SV40, and P2AExpressionMammalianMutation*see comment belowPromoterEFSAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only