We narrowed to 4,583 results for: bre
-
Plasmid#215450PurposeGateway entry vector with integrin beta1 wild-type (WT)DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV-FOXC1-T2A-miRFP670
Plasmid#182336PurposeExpresses human FOXC1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertForkhead Box C1 (FOXC1 Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_on-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233373PurposeEF1α driven co-expression of the consitutively active kinase activity recorder positive control Kinprola_on fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_on-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_PKA_T/A-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233372PurposeEF1α driven co-expression of the inactive PKA activity recorder negative control with T/A mutation Kinprola_PKA_T/A fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_PKA_T/A-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactive+sgAAVS1_118
Plasmid#213171PurposeVector with sgAAVS1 used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorInsertsgAAVS1_118 (AAVS1 Human)
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_FtoW
Plasmid#224254PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_FtoWDepositorInserthnRNPA1_FtoW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationF17W, F25W, F31W, F37W, F43W, F62W, F69W, F78W, F…PromoterT7Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
AAV2_CAG_oROS-HT(C199S)_WPRE
Plasmid#216415PurposeEncodes the loss-of-function mutation C199S of genetically encoded, chemigenetic fluorescent peroxide sensor oROS-HT in AAV viral vectorsDepositorInsertoROS-HT(C199S)
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Uncx [N155/9R]
Plasmid#114545PurposeMammalian Expression Plasmid of anti-Uncx (Mouse). Derived from hybridoma N155/9.DepositorInsertanti-Uncx (Mus musculus) recombinant mouse monoclonal antibody (Uncx Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Uncx [N155/9R]
Plasmid#206537PurposeMammalian Expression Plasmid of anti-Uncx (Mouse). Derived from hybridoma N155/9.DepositorInsertanti-Uncx (Mus musculus) recombinant Mouse monoclonal antibody (Uncx Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-SOX2-T2A-miRFP670
Plasmid#187375PurposeExpresses human SOX2 and miRFP670 via T2A linker under control of a CMV promoter.DepositorAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSNA-c029
Plasmid#175471PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R and H288A point mutations that reduce binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-POLB-KO-g1
Plasmid#176090PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassetteDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (constant) [N212/7R]
Plasmid#177514PurposeMammalian Expression Plasmid of anti-TRIP8b (constant) (Rat). Derived from hybridoma N212/7.DepositorInsertanti-TRIP8b (constant) (Rattus norvegicus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263E
Plasmid#141340PurposeLentiviral vector for expression of human NHEJ1-S263E in mammalian cellsDepositorInsertNHEJ1-S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263A
Plasmid#141341PurposeLentiviral vector for expression of human NHEJ1-S263A in mammalian cellsDepositorInsertNHEJ1-S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b [N212/7R]
Plasmid#164154PurposeMammalian Expression Plasmid of anti-TRIP8b (Rat). Derived from hybridoma N212/7.DepositorInsertanti-TRIP8b (Rattus norvegicus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Iduna/RNF146 [N201/35R]
Plasmid#164157PurposeMammalian Expression Plasmid of anti-Iduna/RNF146 (Mouse). Derived from hybridoma N201/35.DepositorInsertanti-Iduna/RNF146 (Mus musculus) recombinant mouse monoclonal antibody (Rnf146 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-ZNF423 [N328B/37R]
Plasmid#140077PurposeMammalian Expression Plasmid of anti-ZNF423 (Human). Derived from hybridoma N328B/37.DepositorInsertanti-ZNF423 (Human) recombinant mouse monoclonal antibody (ZNF423 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRISM-Fuse-cmlc2-mRFP
Plasmid#117787PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorInsertmRFP
UseSynthetic BiologyAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-REEP1/2 [N326D/29R]
Plasmid#114510PurposeMammalian Expression Plasmid of anti-REEP1/2 (Mouse). Derived from hybridoma N326D/29.DepositorInsertanti-REEP1/2 (Mus musculus) recombinant mouse monoclonal antibody (Reep1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-PARIS/ZNF746 [N196/16R]
Plasmid#114475PurposeMammalian Expression Plasmid of anti-PARIS/ZNF746 (Human). Derived from hybridoma N196/16.DepositorInsertanti-PARIS/ZNF746 (Homo sapiens) recombinant mouse monoclonal antibody (ZNF746 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-Malin [N85/18.1R]
Plasmid#114513PurposeMammalian Expression Plasmid of anti-Malin (Human). Derived from hybridoma N85/18.1.DepositorInsertanti-Malin (Homo sapiens) recombinant mouse monoclonal antibody (NHLRC1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Stonin-2 [N346/9R]
Plasmid#114484PurposeMammalian Expression Plasmid of anti-Stonin-2 (Human). Derived from hybridoma N346/9.DepositorInsertanti-Stonin-2 (Homo sapiens) recombinant mouse monoclonal antibody (STON2 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_3xflag_CHEK2
Plasmid#136526PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorAvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 hygro
Plasmid#104995PurposeThis lentiviral construct delivers hSpCas9 and hygromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 neo
Plasmid#104996PurposeThis lentiviral construct delivers hSpCas9 and G418 resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA puro
Plasmid#104990PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and puromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA hygro
Plasmid#104991PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and hygromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PARP1 FL
Plasmid#169815PurposeExpresses codon optimised full length His tagged PARP1 in bacterial cellsDepositorInsertPoly[ADP-ribose] polymerase 1 (PARP1 Codon optimised, Synthetic, Human)
TagsMKHHHHHHMKQExpressionBacterialMutationValine 762 mutated to an alaninePromoterT7 promoterAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA blast
Plasmid#104993PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and blasticidin S resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-zSpG
Plasmid#179316PurposeIn vitro transcription of SpG-Cas9 mRNA zebrafish codon-optimized from T3 promoterDepositorInsertZebrafish codon-optimized Cas9 variant SpG
UseCRISPR; In vitro transcription by t3 promoterTagsSV40-NLSMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-zSpRY
Plasmid#179317PurposeIn vitro transcription of SpRY-Cas9 mRNA zebrafish codon-optimized from T3 promoterDepositorInsertZebrafish codon-optimized Cas9 variant SpRY
UseCRISPR; In vitro transcription by t3 promoterTagsSV40-NLSMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 puro
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRM210 LGP (Luciferase GFP Puro)
Plasmid#174722PurposeExpresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance geneDepositorInsertsFirefly Luciferase
eGFP
pac
UseLentiviral and LuciferaseTagsE2A linker and F2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-eGFP…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only