We narrowed to 3,374 results for: N-EGFP
-
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2 LRP6-APEX2-Ires-eGFP-PAC
Plasmid#180142Purposeused to biotinylate targets that are recruited near the receptor during Wnt signaling at different time periodsDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC_SiR-tag-Pro30-mEGFP-NLS3x
Plasmid#249672PurposeExpression of silicon rhodamine-binding protein tag fused to mEGFP (nuclear) in zebrafishDepositorInsertSiR-tag-Pro30-mEGFP-NLS3x
UseZebrafish expressionAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1-H2B-mRFP1-pcdk1-EGFP1-FRT
Plasmid#247334PurposeExpresses histone H2B fused with mRFP1, together with monomeric EGFPDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianPromoterCAG promoterAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-pri-miR-137
Plasmid#235159PurposeExpresses EGFP and miR-137 primary transcript in a Cre recombinase-dependent mannerDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
NK10 SFFV-mCherry-SG(s70587-3xMS2)SG-EGFP (FLP-IN)
Plasmid#191165PurposeExpression of a sensor for synthetic sequence 1 (EK0208) with three MS2 sequences in the coding sequence in mammalian cells. Similar to EK0438, but with MS2 sequences directly after the sensor sequence, rather than 3' UTRDepositorInsertmCherry:s70587-3xMS2:EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT EGFP-miniAID
Plasmid#101714PurposeFor amplification of a EGFP-miniAID for N-terminal taggingDepositorInsertEGFP-miniAID
TagsEGFP-miniAIDExpressionMammalianAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-ActA-pEGFP-C1
Plasmid#177412PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-ActA: Bcl-XL with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-XL-ActA, BclX-acta
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-pEGFP-C1
Plasmid#177414PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-ActA-pEGFP-C1
Plasmid#177418PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-ActA: Bcl-2 with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-2-ActA, Bcl2-acta, Bcl-acta
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-ActA-pEGFP-C1
Plasmid#177419PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-ActA: Bcl-2 with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-2-ActA, Bcl2-acta, Bcl-acta
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-cb5-pEGFP-C1
Plasmid#177421PurposeExpress mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-cb5-pEGFP-C1
Plasmid#177422PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_wt_eGFP
Plasmid#208876PurposeExpress eGFP-CCM2 in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_I432D_eGFP
Plasmid#208879PurposeExpress eGFP-CCM2 with the I432D mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_W421AD422A_eGFP
Plasmid#208880PurposeExpress eGFP-CCM2 with the W421A and D422A mutations in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_I428S_eGFP
Plasmid#208878PurposeExpress eGFP-CCM2 with the I428S mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF143-wArchon1-KGC-EGFP-ER2
Plasmid#108429PurposeCodon-optimized Archon1 fluorescent voltage reporter in C.elegans expression plasmidDepositorInsertwArchon1-KGC-EGFP-ER2
ExpressionWormPromoterflp-18Available SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only