We narrowed to 41,301 results for: LAT;
-
Plasmid#169824PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1859A; TCCC -> AGTC silent mutations at…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV9-X1.1
Plasmid#196836Purposenon-standard AAV2 rep-AAV9-X1.1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV9-X1.1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV1.X1
Plasmid#209780Purposenon-standard AAV2 rep-AAV1-X1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV1-X1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDCAF3-IS5
Plasmid#65220PurposeExpresses N-demethylases for the degredation of caffeine and related methylxanthines. Can be used to measure caffeine content as described in the publication listed below.DepositorInsertsndmA
ndmB
ndmC
ndmD
gst9
chlR
UseSynthetic BiologyExpressionBacterialMutationChanged start codon from gtg to atg and Changed s…PromoterBBa_J23100Available SinceJan. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR (mut - miR-206 site)
Plasmid#62576PurposeTranslational Luciferase Reporter containing the mutated 3'UTR of RASA1. The miR-206 binding site was mutated.DepositorInsertRASA1 (RASA1 Human)
UseLuciferaseTagsNoneMutationmiR-206 binding site mutated (ACATTCCA --> AAC…Available SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_BRAF_ex15_V600E_S607S_1.8kb
Plasmid#183078PurposerAAV transfer plasmid with ITRs flanking: (1) BRAF V600E (T>A), S607S (TCC>AGT), 1.8kb homologous recombination donor template centered on BRAF exon 15 with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertBRAF Exon 15, 1.8kb homologous recombination donor, ~900 bp homology arms (BRAF Human)
UseAAV; Homologous recombination donor templateMutationV600E (T>A), S607S (TCC>AGT)PromoterNone for primary insert. PGK for puromycin resist…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBR HPV31 9E
Plasmid#221009PurposeHuman papillomavirus 31 isolate 9E, complete genome cloned in pBR322DepositorInsertHuman papillomavirus type 31 genome 9E isolate
UseCloning vectorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZE21-GFPaav
Plasmid#26643DepositorInsertpZE21-GFPaav
TagsGFPaavExpressionBacterialMutationnaAvailable SinceJune 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-HhR_E
Plasmid#146247PurposeInsect Expression of HhRDepositorInsertHhR
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-HSL_E
Plasmid#146248PurposeInsect Expression of HSLDepositorInsertHSL
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNAFlagMenin WT
Plasmid#32079DepositorInsertMenin
TagsFlagExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only