We narrowed to 3,471 results for: gfp lenti
-
Plasmid#231905PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '2-plasmid' system and packaging EGFP mRNA into the VLPsDepositorUseLentiviralMutationR203M in N proteinPromoterCMV, EF-1aAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
SIN40C.SFFV.GFP.miR-ctrl
Plasmid#169305PurposeConstitutive overexpression of miR-ctrl with GFP as a reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsEGFPPromoterSFFVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
iNos-eGFP
Plasmid#207251PurposeReporter for expression of eGFP under control of iNos promoterDepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP C1
Plasmid#202424PurposeEncodes GFP aloneDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-99a
Plasmid#169304PurposeConstitutive overexpression of miR-99a with GFP as a reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.dTomato.miR-ctrl.PGK.sfGFP.P2A.Tet3G
Plasmid#169316PurposeDoxycycline-inducible expression of miR-ctrl with dTomato as reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsdTomatoPromoterTREAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-hNG2-GFP
Plasmid#183910PurposeExpression of GFP under the human NG2 promoterDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-BAF_L58R
Plasmid#101776PurposeExpresses EGFP tagged mutant BAF (L58R) in human cellsDepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceJan. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.eGFP-miR30n
Plasmid#90333PurposemiR30 based shMir knockdownDepositorInsertseGFP
na
SFFV
miR30n
UseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-Thy1.2-P2A-GFP-T2A-Nef
Plasmid#126553PurposeReplication incompetent HIV with H13L Tat and GFP-t2a-Thy1.2 reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsThy1.2 and GFPPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-VP64 dCas9 VP64-T2A-GFP
Plasmid#59791PurposeCo-expresses human optimized S. pyogenes dCas9 fused to two copies of VP64 and GFPDepositorInserthumanized VP64 dead Cas9 VP64 T2A GFP
UseCRISPR and LentiviralTagsFlagExpressionMammalianMutationD10A and H840AAvailable SinceOct. 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP-BAF
Plasmid#101772PurposeExpresses EGFP tagged BAF in human cellsDepositorAvailable SinceJan. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
WT Smarca4-sfGFP
Plasmid#107056PurposeExpression of wild-type Smarca4 (Brg1) with C-terminal super-folder GFP fusion.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsSuper-folder GFP (sfGFP)ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
paGFP-Omp25
Plasmid#69598Purposeexpresses GFP-labeled mitochondrial outer membrane protein 25DepositorInsertpaGFP-Omp25 (Synj2bp Rat)
UseLentiviralTagsGFPExpressionMammalianMutationphotoactivatable GFP fused to rat Omp25 C-terminusPromoterCMVAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only