We narrowed to 2,481 results for: CLU
-
Plasmid#84896PurposeDONOR vector for Gateway cloning of TAF15 No StopDepositorAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23 C3_20
Plasmid#60303PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_33
Plasmid#60312PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
t206-405
Plasmid#166132PurposeFor expression of human talin-1 head fragment (residues 206-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-F2F3(206-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 206-405 onlyAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del37/GAG)
Plasmid#166129PurposeExpression of human talin-1 head (aa1-405) in E. coli. Contains 37 amino acid deletion in F1-loop, replaced with Gly-Ala-Gly. N-terminal His6, Xpress-epitopeDLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(del37/GAG) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405, with 37 aa deletion in the F1-loop which…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OKM
Plasmid#136554PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Klf4, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KSM
Plasmid#136553PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSM
Plasmid#136555PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del30)
Plasmid#166128PurposeExpression of human talin-1 head (residues 1-405) in E. coli. Contains 30 amino acid deletion in F1-loop. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-405(del30) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, with 30 amino acid deletion in th…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a No Stop
Plasmid#84894PurposeDONOR vector for Gateway cloning of EWSR1 g1750a No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a Stop
Plasmid#84893PurposeDONOR vector for Gateway cloning of EWSR1 g1750a StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t Stop
Plasmid#84891PurposeDONOR vector for Gateway cloning of EWSR1 c1655t StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only