We narrowed to 3,780 results for: N-EGFP
-
Plasmid#177410PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-ActA: Bcl-XL with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-XL-ActA, BclX-acta
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-BclXL-Cb5-pEGFP-C1
Plasmid#177415PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
UbG76V-eGFP-V5His_20aa
Plasmid#23970DepositorInsertUb-G76V-eGFP-V5HIS_20aa
TagseGFPExpressionMammalianMutationG76V mutation in Ubiquitin. Ub fused to N-termin…Available SinceMarch 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
sc AAV miR26a eGFP
Plasmid#21894DepositorInsertEF1 alpha -miR26a GFP p(A)
UseAAV; ScTagsGFPExpressionMammalianMutationN/AAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab5A Q79L
Plasmid#28046DepositorAvailable SinceFeb. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-TAX1BP1
Plasmid#175766PurposeLentiviral vector expressing N-terminally tagged eGFP-TAX1BP1DepositorInsertTAX1BP1 (TAX1BP1 Human)
UseLentiviralAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab5A S34N
Plasmid#28045DepositorAvailable SinceFeb. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET28a-eGFP-MinD
Plasmid#133622PurposeExpression vector for the Escherichia coli MinD with an N-terminal fusion of a His-tag for purification and an EGFP for visualization.DepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV-EGFP-C
Plasmid#13887DepositorInsertC domain of N-WASP (WASL Bovine)
UseAdenoviralTagsEGFPMutationThe BglII site in the MCS of pShuttle-CMV was fil…Available SinceFeb. 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1 K56R-WPRE
Plasmid#250371PurposeLentiviral expression of human MTHFD1 carrying K56R mutation with N-terminal EGFP and puromycin resistance cassette under PGK promoter. Mutation was generated by Q5 site-directed mutagenesis.DepositorInsertMTHFD1 (MTHFD1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationK56RPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1 K384E-WPRE
Plasmid#250372PurposeLentiviral expression of human MTHFD1 carrying K384E mutation with N-terminal EGFP and puromycin resistance cassette under PGK promoter. Mutation was generated by Q5 site-directed mutagenesis.DepositorInsertMTHFD1 (MTHFD1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationK384EPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2 LRP6-APEX2-Ires-eGFP-PAC
Plasmid#180142Purposeused to biotinylate targets that are recruited near the receptor during Wnt signaling at different time periodsDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC_SiR-tag-Pro30-mEGFP-NLS3x
Plasmid#249672PurposeExpression of silicon rhodamine-binding protein tag fused to mEGFP (nuclear) in zebrafishDepositorInsertSiR-tag-Pro30-mEGFP-NLS3x
UseZebrafish expressionAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1-H2B-mRFP1-pcdk1-EGFP1-FRT
Plasmid#247334PurposeExpresses histone H2B fused with mRFP1, together with monomeric EGFPDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianPromoterCAG promoterAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV[FLEX]-CAG-EGFP-pri-miR-137
Plasmid#235159PurposeExpresses EGFP and miR-137 primary transcript in a Cre recombinase-dependent mannerDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
NK10 SFFV-mCherry-SG(s70587-3xMS2)SG-EGFP (FLP-IN)
Plasmid#191165PurposeExpression of a sensor for synthetic sequence 1 (EK0208) with three MS2 sequences in the coding sequence in mammalian cells. Similar to EK0438, but with MS2 sequences directly after the sensor sequence, rather than 3' UTRDepositorInsertmCherry:s70587-3xMS2:EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only