We narrowed to 21,121 results for: REV
-
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:Venus-Tub1+3'UTR::LEU2
Plasmid#50644DepositorInsertVenus-Tub1
UseYeast expressionTagsVenusPromoterHIS3pAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mEos2-Tub1+3'UTR::TRP1
Plasmid#50652DepositorInsertmEos2-Tub1
UseYeast expressionTagsmEos2PromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mTurquoise2-Tub1+3'UTR::TRP1
Plasmid#50647DepositorInsertmTurquoise2-Tub1
UseYeast expressionTagsmTurquoise2PromoterHIS3pAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHIS3p:mEos2-Tub1+3'UTR::HPH
Plasmid#50634DepositorInsertmEos2-Tub1
UseYeast expressionTagsmEos2PromoterHIS3pAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-tdMCP-msfGFP(V206K)-GBI
Plasmid#205163Purposeexpress tdMCP-msfGFP(V206K)-GBIDepositorInserttdMCP-msfGFP(V206K)-GBI
ExpressionBacterial and MammalianPromoterCMVAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-HygroR-T2A-TetOn3G
Plasmid#179887PurposeExpresses TetOn3G transcription factor selectable by hygromycin resistance (Lentiviral vector)DepositorInsertTetOn3G
UseLentiviralTagsHygromycin resistanceExpressionBacterial and MammalianPromoterEF1aAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gene Trap - 24XPP7 Lentiviral Vector
Plasmid#174199PurposeLentiviral expression vector coding for Blasticidin, iRFP and 24X PP7 hairpins. All inserts are cloned in on the -strand to allow for splicing in when targeted into an intron of transcribed genes.DepositorInsertiRFP
UseLentiviral; VectorTags24X PP7 hairpins, Blasticidin, and T2AExpressionMammalianAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only