We narrowed to 5,551 results for: crispr cas9 grna plasmid

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#163707

Yeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domain

Yvonne Nygård

Camara et al Sci Rep. 2020 Sep 3;10(1):14605. doi: 10

Nov. 1, 2021

Academic Institutions and Nonprofits only

#199700

encodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherry

David Nemazee

May 22, 2024

Academic Institutions and Nonprofits only

#49330

Expresses sgRNA and Cas9-Puro in Drosophila S2 cells

Ji-Long Liu

Bassett et al Biol Open. 2013 Dec 10. pii: bio.2013712

Dec. 19, 2013

Academic Institutions and Nonprofits only

#206936

Expression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.

Markus Grompe

Sept. 13, 2023

Academic Institutions and Nonprofits only

#176259

pNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI and

John van der Oost

Naduthodi et al ACS Synth Biol. 2021 Dec 17;10(12):3369-

Oct. 28, 2021

Academic Institutions and Nonprofits only

#80768

All-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty.

Kazuhisa Nakayama

Katoh et al Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-

March 15, 2017

Academic Institutions and Nonprofits only

#90278

BB3_L 23_gRNAempty_cas9_BbsI; CRISPR plasmid with empty gRNA spacer to incorporate gRNA, Cas9

Michael Sauer

Sarkari et al Bioresour Technol. 2017 May 4. pii: S096

July 19, 2017

Academic Institutions and Nonprofits only

#255027

Lentiviral plasmid designed to express a SaCas9 compatible gRNA expression cassette and dSaCas9-KRAB-T2A-GFP protein; Similar to Plasmid #162334, but with GFP instead of Puro

Jonathan Ploski

May 7, 2026

Academic Institutions and Nonprofits only

#124774

3rd generation lentiviral plasmid encoding Cas9, TagBFP2, and a gRNA backbone

Jason Sheltzer

Giuliano et al Curr Protoc Mol Biol. 2019 Sep;128(1):e1

Oct. 11, 2019

Academic Institutions and Nonprofits only