We narrowed to 12,102 results for: cel.2;
-
Plasmid#179972PurposeMammalian expression vector for SARS-CoV-2 Nsp1, V5-tagged. Sequence codon-optimized.DepositorInsertSARS-CoV-2 Nsp1 (ORF1ab Synthetic)
UseTagsExpressionMammalianMutationhuman codon-optimizedPromoterAvailable sinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pMSCV-IRES-GFP-MyD88 (S34Y)-CpLxIS
Plasmid#131349PurposeExpresses MyD88 S34Y with 2 copies of pLxIS motif from STING fused to its C-terminusDepositorInsertMyD88 (S34Y)-CpLxIS (Myd88 Mouse)
UseRetroviralTagsExpressionMammalianMutationMyD88 (S34Y)PromoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/HIS/FLAG/HA-MYEF2
Plasmid#38069DepositorInsertMYEF2 myelin expression factor 2 (MYEF2 Human)
UseTagsHIS/FLAG/HAExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmAGO2-RC_B
Plasmid#145980PurposeInsect Expression of DmAGO2-RCDepositorInsertDmAGO2-RC (AGO2 Fly)
UseTagsExpressionInsectMutationA deletion of AA 51-56 and an insertion of 23 AA …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (P.1 lineage / Brazilian variant)
Plasmid#169847PurposeMammalian expression plasmid for S of SARS-CoV-2 (P.1 lineage / Brazilian variant) with N-terminal c-myc tagDepositorInsertProtein S
UseTagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (B.1.1.7 lineage / UK variant)
Plasmid#169848PurposeMammalian expression plasmid for S of SARS-CoV-2 (B.1.1.7 lineage / UK variant) with N-terminal c-myc tagDepositorInsertProtein S
UseTagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIV_Gag_Pol
Plasmid#236243Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV Gag and PolDepositorInsertSIV Gag and Pol
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CRY-Gal∆DD (B1013)
Plasmid#92035PurposeExpresses CRY2 (full-length, with endogenous NLS) fused to Gal4 (aa1-65 of Gal4BD), downstream of mCherry-IRESDepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationFusion of plant CRY2 to Gal4 binding domain (AA1-…PromoterAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Venus-Puma-pEGFP-C1
Plasmid#166739PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, PumaDepositorInsertPuma (BBC3 Human)
UseTagsVenusExpressionMammalianMutationPromoterCMVAvailable sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
CRY-GalVP16l (B694)
Plasmid#92030Purposeexpresses CRY2 (Full length, mutant NLS) fused to Gal4DNA (residues 1-147) fused to VP16 activation domain (long form)DepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagsGalBD-VP16ExpressionMammalianMutationNLS sequence of CRY2 mutatedPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmAGO2-RC_B
Plasmid#145981PurposeInsect Expression of DmAGO2-RCDepositorInsertDmAGO2-RC (AGO2 Fly)
UseTagsExpressionInsectMutationA deletion of AA 51-56 and an insertion of 23 AA …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only