We narrowed to 1,897 results for: mcherry expressing plasmid
-
Plasmid#129561Purposecytomplasmic marker without terminator (less integration)DepositorInsertmCherry
ExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC533
Plasmid#135435PurposeYeast integrating plasmid for pTEF1-mCherry reporter geneDepositorInsertmCherry
ExpressionYeastMutationcodon optimized for S. cerevisiaePromoterpTEF1Available SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTKIU-Tyr
Plasmid#247649PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmidDepositorInsertsGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
Ulp1 SUMO protease
UseMycobacterial integratingTags3xFLAG tag, HA tag, and Myc tagExpressionBacterialPromoterPTet and PTet (co-operonic with GFP-SUMO-Ser-mChe…Available SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKIU-Ser
Plasmid#247650PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmidDepositorInsertsGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
Ulp1 SUMO protease
UseMycobacterial integratingTags3xFLAG tag, HA tag, and Myc tagExpressionBacterialPromoterPTet and PTet (co-operonic with GFP-SUMO-Ser-mChe…Available SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2E2-HA-mCh
Plasmid#129596PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody variant-mCherry (2E2-HA scFv-mCherry)
ExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
CYLBL_Neo_TREdCas9-KRAB
Plasmid#251231PurposeTRE-dCas9-KRAB knock-in using TALEN at CLYBL locus (derived from Plasmid #220439)DepositorInsertTRE-dCas9 KRAB
UseCRISPR and TALENTagsKRABExpressionMammalianMutationD10A and H840APromoterTREAvailable SinceMarch 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJR255
Plasmid#78549PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. CMV driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, CMVAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJR288
Plasmid#78550PurposeFor expressing small noncoding RNAs from U6 promoter. One step cloning of oiigonucleotide pairs containing CACC and AAAA overhangs. Ef1a driven mCherry visible marker.DepositorTypeEmpty backboneUseRNAiExpressionMammalianPromoterU6, EF1aAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKS011
Plasmid#65464PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) MBP (Maltose Binding Protein), Ntag, and mCherryDepositorInsertMBP-Ntag-mCherry
TagsFLAG and MBPExpressionBacterialPromoterpl-TetOAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKS012
Plasmid#65465PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) Ntag and mCherryDepositorInsertNtag-mCherry
UseSynthetic BiologyTagsFLAGExpressionBacterialPromoterpl-TetOAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDNR-3xFLAG-T2A-3xPuroR-Frame 1
Plasmid#245867PurposeHITAG Donor plasmid for Frame 1 with 3xFLAG tag and triple Puromycin resistant marker (3xPuroR)DepositorInsertampicilin resistant marker
UseSynthetic BiologyExpressionBacterial and MammalianAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Human CRISPR-Cas9 Deletion Library - Gene Expression
Pooled Library#101928PurposeBassik lab Human CRISPR-Cas9 Deletion Library - Gene Expression. Coexpresses mCherry.DepositorExpressionMammalianUseCRISPRAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP618_αGCN4-KRAB-CO
Plasmid#211782PurposeSunTag counterpart binding domain, aGCN4, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertaGCN4-mCherry
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect mCherr…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pRN11
Plasmid#84455Purposeshuttle plasmid for sarA P1-mCherry expressionDepositorInsertmCherry
UseShuttle vector e.coli-s.aureus, expression of sgf…Available SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
Plasmid#198417PurposeExpresses both OsTIR1F74A and mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertOsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only