We narrowed to 8,906 results for: sgrna
-
Plasmid#133043PurposeDoxycycline-inducible SiC-V2 vector with Cas9G7 (sgRNA 7 targeting SpCas9 gene). In cells coexpressing Cas9 nuclease, this construct causes self-inactivation/editing of SpCas9 gene upon Dox addition.DepositorInsertTet repressor
UseLentiviralTagsCeruleanAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pPFK300_Cas9
Plasmid#104912PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2 control
Plasmid#217443PurposeLentiviral vector expressing Cas9 without a targeting sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
epi-ABEmax-NG
Plasmid#135976PurposeExpresses ABEmax(with SpCas9-NG), EBNA1 and blasticidin resistence gene; cloning backbone for sgRNA; Contains Epstein-Barr virus oriP replication originDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg2dCas9-KRAB-T2a-GFP
Plasmid#234881PurposeL1HS-silencing plasmid (CRISPRi gRNA2)DepositorInsertLacZ gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Sa-SauriCas9
Plasmid#135967PurposeExpresses Sa-SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TJP1
Plasmid#227300PurposeDonor template for mStayGold insertion into the N-terminus of the TJP1 locus. For tight junction visualization. To be co-transfected with sgRNA plasmid px330-TJP1 (Addgene #227299)DepositorInsertTJP1 Homology Arms flanking a mStayGold Tag (TJP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only