We narrowed to 11,308 results for: ena
-
Plasmid#183315PurposeAll-in-One CRISPRko system with a guide RNA that targets PIGF geneDepositorInsertPIGF
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MET
Plasmid#183310PurposeAll-in-One CRISPRko system with a guide RNA that targets MET geneDepositorInsertMET
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K2
Plasmid#183309PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K2 geneDepositorInsertMAP2K2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K1
Plasmid#183308PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K1 geneDepositorInsertMAP2K1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_LCK
Plasmid#183307PurposeAll-in-One CRISPRko system with a guide RNA that targets LCK geneDepositorInsertLCK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_KIT
Plasmid#183306PurposeAll-in-One CRISPRko system with a guide RNA that targets KIT geneDepositorInsertKIT
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_KDR
Plasmid#183305PurposeAll-in-One CRISPRko system with a guide RNA that targets KDR geneDepositorInsertKDR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK3
Plasmid#183304PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK3 geneDepositorInsertJAK3
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK1
Plasmid#183302PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK1 geneDepositorInsertJAK1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FYN
Plasmid#183295PurposeAll-in-One CRISPRko system with a guide RNA that targets FYN geneDepositorInsertFYN
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CYP17A1
Plasmid#183279PurposeAll-in-One CRISPRko system with a guide RNA that targets CYP17A1 geneDepositorInsertCYP17A1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CSF3R
Plasmid#183278PurposeAll-in-One CRISPRko system with a guide RNA that targets CSF3R geneDepositorInsertCSF3R
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK6
Plasmid#183276PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK6 geneDepositorInsertCDK6
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK4
Plasmid#183275PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK4 geneDepositorInsertCDK4
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BTK
Plasmid#183274PurposeAll-in-One CRISPRko system with a guide RNA that targets BTK geneDepositorInsertBTK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BCL2
Plasmid#183272PurposeAll-in-One CRISPRko system with a guide RNA that targets BCL2 geneDepositorInsertBCL2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AR
Plasmid#183271PurposeAll-in-One CRISPRko system with a guide RNA that targets AR geneDepositorInsertAR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ALK
Plasmid#183270PurposeAll-in-One CRISPRko system with a guide RNA that targets ALK geneDepositorInsertALK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ADA
Plasmid#183269PurposeAll-in-One CRISPRko system with a guide RNA that targets ADA geneDepositorInsertADA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CcCDP_p15A
Plasmid#179272PurposeExpresses CcCDP in E. coli BL21(DE3)DepositorInsertcellodextrin phosphorylase
UseSynthetic BiologyTags6xHISExpressionBacterialPromoterT7 lacOAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK73_htz-1
Plasmid#174546Purposehtz-1 targeting gRNA expressionDepositorInserthtz-1 targeting gRNA
ExpressionWormPromoterCe-U6 promoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC031
Plasmid#171152PurposepGNW2 derivative with integration site at P. putida prophage1 for integration of J3-BBa_J23117-mRFP cassetteDepositorInsertJ3-BBa_J23117-mRFP
ExpressionBacterialPromoterJ3-BBa_J23117Available SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC034
Plasmid#171153PurposepGNW2 derivative with integration site at P. putida prophage2 for integration of J3(106)-BBa_J23111-sfGFP cassetteDepositorInsertJ3(106)- BBa_J23111-sfGFP
ExpressionBacterialPromoterJ3(106)-BBa_J23111Available SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC016.109
Plasmid#171144PurposeExpression of J1-BBa_J23117-mRFP and J109 scRNA on pBBR1-GmR plasmidDepositorInsertsJ109 scRNA
J1-BBa_J23117-mRFP
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J1-BBa_J23117Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC008.106
Plasmid#171141PurposeExpression of J106 scRNA on pBBR1-GmR plasmidDepositorInsertJ106 scRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0-BvCYP76AD1
Plasmid#162529PurposeBeta vulgaris cytochrome P450 76AD1 coding sequence in pICH41308 MoClo Golden Gate level 0 acceptor for CDS1 modules.DepositorInsertCYP76AD1
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL0-MjcDOPA5GT
Plasmid#162530PurposeMirabilis jalapa cyclo-DOPA 5-O-glucosyltransferase coding sequence in pICH41308 MoClo Golden Gate level 0 acceptor for CDS1 modules.DepositorInsertcDOPA5GT
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS11: pTns(AvCAST)_ΔTniQ,ΔTnsD
Plasmid#168144PurposeInducible expression of AvCAST TnsA, TnsB and TnsC proteins.DepositorInsertAvCAST Tns proteins (TnsA, TnsB and TnsC)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS9: pTns(AvCAST)_ΔTniQ
Plasmid#168142PurposeInducible expression of AvCAST TnsA, TnsB, TnsC and TnsD proteins.DepositorInsertsAvCAST Tns proteins (TnsA, TnsB and TnsC)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Ec-2
Plasmid#163128PurposepLyGo cloning vector for periplasmic expression in E. coli of a sequence of interest (LPMO). Vector encoding MalE signal peptide and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterT7Available SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM9121_Hsa-Serum Albumin SP
Plasmid#153496PurposeHuman Serum Albumin Signal Peptide Donor PlasmidDepositorInsertSerum Albumin SP
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM9121_Sce-Killer Protein SP
Plasmid#153498PurposeS. cerevisiae Killer Signal Peptide Donor PlasmidDepositorInsertKiller Protein SP
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM9121_Cfo-CPO SP
Plasmid#153500PurposeCaldariomyces (Leptoxyphium) fumago Chloroperoxidase Signal Peptide Donor PlasmidDepositorInsertChloroperoxidase SP
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM9121_TEV-His-GFP11
Plasmid#153510PurposeTEV-His-GFP11 C-terminal Tag Donor PlasmidDepositorInsertTEV-His-GFP11
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGM9121_Sce-Acid Phosphatase SP
Plasmid#153494PurposeS. cerevisiae Acid Phosphatase Signal Peptide Donor PlasmidDepositorInsertAcid Phosphatase SP
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
plIVMD163
Plasmid#160935PurposeIn vivo mRNA display construct for mCherryDepositorInsertMCP-mCherry-HIS tag, 3'UTR MS2 Stem Loop
TagsHIS tag, 3'UTR MS2 Stem LoopExpressionYeastPromoterMET25Available SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only