We narrowed to 1,710 results for: Green fluorescence protein
-
Plasmid#180754PurposepET30 vector with sfGFP-S-tag inserted between the Bgl II and T7 terminatorDepositorInsertsuperfolder green fluorescent protein
UseTagsstrep tagExpressionBacterialMutationG140C- Please see depositor commentsPromoterAvailable sinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP222-AAV-CMV-GFP-pA
Plasmid#62916PurposeAAV vector backbone designed to express GFP from a CMV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVTagsExpressionMutationPromoterCMVAvailable sinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP220-AAV-0.5Synapsin-GFP-pA
Plasmid#62920PurposeAAV vector backbone designed to express GFP from a 0.5Synapsin promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVTagsExpressionMutationPromoter0.5synapsinAvailable sinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP218-AAV-1.3αCaMKII-GFP-pA
Plasmid#62922PurposeAAV vector backbone designed to express GFP from a 1.3CaMKIIa promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseAAVTagsExpressionMutationPromoter1.3αCaMKIIAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP219-AAV-1.1Synapsin-GFP-pA
Plasmid#62921PurposeAAV vector backbone designed to express GFP from a 1.1Synapsin promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVTagsExpressionMutationPromoter1.1SynapsinAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP214-Lenti-0.5Synapsin P-GFP- WPRE-pA
Plasmid#62929PurposepLenti vector backbone designed to express GFP from a 0.5Synapsin promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralTagsExpressionMutationPromoter0.5synapsin and 1.3αCaMKIIAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP215-Lenti-0.4CaMKIIa P-GFP-WPRE-pA
Plasmid#62927PurposepLenti vector backbone designed to express GFP from a 0.4CaMKIIa promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralTagsExpressionMutationPromoter0.4αCaMKII and 1.3αCaMKIIAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP213-Lenti-1.1Synapsin P-GFP-WPRE-pA
Plasmid#62930PurposepLenti vector backbone designed to express GFP from a 1.1Synapsin promoter .DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralTagsExpressionMutationPromoter1.1Synapsin and 1.3αCaMKIIAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-sfGFP-pA-FRT-Amp-FRT
Plasmid#176620Purposefor generating PCR templates with sfGFP and Amp for BAC recombinationDepositorInsertsuper folder green fluorescent protein with FRT-flanked ampicillin cassette
UseUnspecifiedTagsExpressionMutationH217R - please see dep. commentsPromoterAvailable sinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
Plasmid#91802PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-X2
Plasmid#115567PurposeGFP tethered to two repeats of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationTwo repeats of the Gcn5 consensus motif are tagge…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X1
Plasmid#115566PurposeGFP tethered to a single repeat of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
UseTagsExpressionBacterial and YeastMutationSingle Gcn5 consensus motif repeat tethered to C-…PromoterADH1Available sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
FR_GFP
Plasmid#31302DepositorInsertgreen fluorescent protein
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-CAG-GFP-EnvA(N2c)
Plasmid#194353PurposeLentivirus expressing eGFP and (EnvA-N2c Rabies Glycoprotein) fusion protein. Used to package EnvA pseudotyped G-deleted Rabies of CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
EnvA-CVS-N2c Rabies Glycoprotein
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationPromoterPTETREGAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
UseTagsExpressionMutationIncludes full 819 bp coding sequence of URA3, 435…PromoterAvailable sinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
UseTagsExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable sinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
UseTagsHis tagExpressionMammalianMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
UseTagsExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available sinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only