We narrowed to 13,655 results for: sgRNA
-
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mouse Brie kinome pooled library, guides 1-4 in lentiCRISPRv2 backbone
Pooled library#75317PurposeMouse sgRNA library in backbone lentiCRISPRv2 targeting 713 kinase genes and containing 2,852 unique sgRNAs along with 100 non-targeting controlsDepositorAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-Nme2_tracr
Plasmid#192146PurposeExpresses Nme2-sgRNA cloned with BspQIDepositorInsertNme2 sgRNA scaffold
UseAAVExpressionMammalianAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable sinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_RUNX1_Nick-38_Dual_sgRNA
Plasmid#173214PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and RUNX1 nick-38 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + RUNX1 Nick-38 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-Blast
Plasmid#159741PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP54-5
Plasmid#65599Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-6
Plasmid#65593Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-5
Plasmid#65591Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-8
Plasmid#65596Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-7
Plasmid#65594Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-3
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos3_AmpR
Plasmid#119146PurposeEncodes sgRNA targeting position 3 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 3 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos7_AmpR
Plasmid#119150PurposeEncodes sgRNA targeting position 7 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 7 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos5_AmpR
Plasmid#119148PurposeEncodes sgRNA targeting position 5 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 5 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos2_AmpR
Plasmid#119145PurposeEncodes sgRNA targeting position 2 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 2 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT003
Plasmid#171628Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-TRAC
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and EF1-aAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by