We narrowed to 9,094 results for: sgRNA
-
Plasmid#163458Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 9 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFB-Puro-A
Plasmid#192506PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a nd a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInserthU6-sgRNA-CS1-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterhU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2645
Plasmid#229529PurposeCarries mIAA7_opt tag, empty sgRNA, and NATR markerDepositorInsertmIAA7_opt - empty sgRNA - NATR
UseCRISPRTags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2646
Plasmid#229530PurposeCarries mAID_opt tag, empty sgRNA, and NATR markerDepositorInsertmAID_opt - empty sgRNA - NATR
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2651
Plasmid#229993PurposeCarries AID* tag, empty sgRNA, and NEOR markerDepositorInsertAID* - empty sgRNA - NEOR
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2 IRF3 KO
Plasmid#217446PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human IRF3DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98972PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNA targeting hLMNA. Generates breaks with 44bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
EC70199
Plasmid#209460PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70206
Plasmid#209467PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterTaU6Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1217
Plasmid#119258Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1071
Plasmid#119245Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1170
Plasmid#119252Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pV1464
Plasmid#111440PurposeN. castellii Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-ZNF865-hUbC-dCas9-KRAB-eGFP
Plasmid#241308Purpose3rd gen lenti vector encoding dCas9 (s. Pyogenes) fused with the KRAB and a 2A eGFP fluorescence marker. Includes guide for suppression of the ZNF865 geneDepositorInsertZNF865 sgRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only