We narrowed to 3,493 results for: cgas
-
Plasmid#246293PurposeEvaluation of CiU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertCiU6.1 promoter
UseCRISPRExpressionPlantPromoterCiU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-14
Plasmid#246297PurposeEvaluation of CiU6.6c16 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.6c16 promoter
UseCRISPRExpressionPlantMutationT-to-C (-2 from TSS)PromoterCiU6.6c16 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-11
Plasmid#246294PurposeEvaluation of CiU6.3c8 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.3c8 promoter
UseCRISPRExpressionPlantMutationA-to-C (-23 from TSS)PromoterCiU6.3c8 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-24
Plasmid#246307PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m4 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m4 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-25
Plasmid#246308PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m5 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m5 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-27
Plasmid#246310PurposeEvaluation of PtU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.1 promoter
UseCRISPRExpressionPlantPromoterPtU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-1
Plasmid#246284PurposeEvaluation of AtU3b promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertAtU3b promoter
UseCRISPRExpressionPlantPromoterAtU3b promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-32
Plasmid#246315PurposeEvaluation of VvU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertVvU6.1 promoter
UseCRISPRExpressionPlantPromoterVvU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-23
Plasmid#246306PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m1 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-20
Plasmid#246303PurposeEvaluation of MtU6.6-189 promoter (Pol III promoter) deletion (189 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-189 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-189 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-29
Plasmid#246312PurposeEvaluation of PtU6.2 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2 promoter
UseCRISPRExpressionPlantPromoterPtU6.2 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-16
Plasmid#246299PurposeEvaluation of HbU6.2m1 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m1 promoter
UseCRISPRExpressionPlantMutationA-to-G (-56 from TSS), C-to-T (-29), G-to-A (-24)PromoterHbU6.2m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp3
Plasmid#238036PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp6
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only