We narrowed to 2,424 results for: dcas9
-
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP
Plasmid#253810PurposeExpress RHOT1 sgRNA under U6 promoter and dCas9-KRAB-T2A-EGFP under hUbC promoterDepositorInsertsgRNA RHOT1 (RHOT1 Human)
UseCRISPR and LentiviralExpressionMammalianPromotersgRNA for U6p and dCas9-KRAB-T2A-GFP for hUbCpAvailable sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-KRAB-dCas9
Plasmid#120356PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS-KRAB-dCas9
Plasmid#120357PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOK+9MS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [1-483]Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T CAG dCas9-10XGcn4-P2A-mCherry BlastR
Plasmid#186745PurposedCas9-10XGcn4-P2A-mCherry expression constructDepositorInsertCas9-10XGcn4-P2A-mCherry
UseCRISPRExpressionMammalianAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGW011b Dual AAV vector pAAV-EFS-dCAS9-spA
Plasmid#192160PurposeDual AAV vector AAV-dCas9DepositorInsertDead Cas9
UseAAVMutationNAAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-p300 core
Plasmid#179554Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT340 Lenti pEF-dCas9-3XFLAG-KRAB[WSR7EEE] + MGA1+2 + RYBP-T2A-tagBFP-P2A-Blast
Plasmid#187344PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-KRAB[WSR7EEE] + MGA1+2 + RYBP-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianMutationKRAB WSR7EEEPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BD10-SAS620-3’dCas9-VPR-synpA
Plasmid#216323PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice acceptor site
UseAAVPromoterCMVAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by