We narrowed to 13,776 results for: sequence
-
Plasmid#204465PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127S mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-A127S mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pMZ103-rbs1-m4
Plasmid#204466PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127T mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-A127T mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m5
Plasmid#204467PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125F-A127G-S129N mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125F-A127G-S129N mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m6
Plasmid#204468PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-S129N-L130V mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-S129N-L130V mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m7
Plasmid#204469PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L125W-A127T-L128M mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L125W-A127T-L128M mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_CD28ICD
Plasmid#197098PurposeThis plasmid contains the coding sequence for the intracellular domain of CD28. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of CD28.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-GTS-TurboID
Plasmid#209397PurposeTransiently expressing TurboID fused with a Golgi targeting sequence (GTS) in plantaDepositorInsertGTS-3XHA-TurboID
ExpressionPlantMutationTurboID gene sequence C249APromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_IRdist_scram
Plasmid#162319PurposeP. aeruginosa PA14 CRISPR2 locus, with a scrambled distal Inverted Repeat of the upstream motifDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutationThe distal Upstream Motif site is scrambledPromoterpBADAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.F02R
Plasmid#198662PurposeEasy-MISE toolkit pEM-plasmid containing GFP coding sequence preceded by a linker sequence with HI protruding endsDepositorInsertlinker+GFP
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.F02L
Plasmid#198661PurposeEasy-MISE toolkit pEM-plasmid containing GFP coding sequence preceded by a linker sequence with CD protruding endsDepositorInsertlinker+GFP
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOAD eIF4G1 (1-341)
Plasmid#196833PurposeExpesses S.cerevisiae eIF4G1 amino acids 1-341 as Gal4 activation domain fusion.DepositorInserteIF4G1 (TIF4631 Budding Yeast)
TagsGal4ExpressionYeastMutationamino acids 1-341PromoterADHAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOBD2 Pab1 WT (123-204)
Plasmid#196834PurposeExpresses Pab1 RRM2 fragment fused to GAL4 DNA binding domainDepositorInsertPab1 (PAB1 Budding Yeast)
TagsGal4ExpressionYeastMutation123-204 amino acidsPromoterADHAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOBD2 Pab1 E181R (123-204)
Plasmid#196835PurposeExpresses Pab1 RRM2 fragment E181R fused to GAL4 DNA binding domainDepositorInsertPab1 (PAB1 Budding Yeast)
TagsGal4ExpressionYeastMutation123-204 amino acids & E181RPromoterADHAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LPLKMLNI_epitope
Plasmid#165015PurposeExpression of CMV UL83 (116-123) fused to IL-2 signal sequenceDepositorInsertCMV UL83 (116-123)
UseLentiviralTagshuman IL2 signal sequence at N-termExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_-6D
Plasmid#149387PurposeP. aeruginosa PA14 CRISPR2 locus, with 6bp deletion downstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation6bp deleted downstream of the IHFprox sitePromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_-5D
Plasmid#149388PurposeP. aeruginosa PA14 CRISPR2 locus, with 5bp deletion downstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation5bp deleted downstream of the IHFprox sitePromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only