We narrowed to 27,867 results for: RON
-
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3831_pGEEC579_pShip-UbC(no_intron)-mRuby2-bGH
Plasmid#239742PurposePlasmid expressing mRuby from a UbC promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3774_pGEEC580_pShip-EF1a(no_intron)-mRuby2-bGH
Plasmid#239743PurposePlasmid expressing mRuby from an EF1a promoter lacking an intron, used for modRNA productionDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-ER WPRE
Plasmid#236230PurposeAAV expression of a fluorescent marker, mEmerald fused to Prolactin signal peptide and KDEL sequence; for expression and retention in the lumen of the endoplasmic reticulumDepositorInsertmEmerald-PRL signal peptide-KDEL sequence (PRL Bovine)
UseAAVTagsmEmeraldPromoterhuman Synapsin 1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-tubgenomic-PTC62-deltaIntron3_D
Plasmid#146146PurposeMammalian Expression of tubgenomic-PTC62-delIntron3DepositorInserttubgenomic-PTC62-delIntron3
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2366 - intron GG3 - 250bp no PATC
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Drosophila Nedd2-like caspase (DRONC)
Plasmid#157778PurposeE. coli expression vector pET23 with C-term 6xHis tagDepositorInsertDrosophila Nedd2-like caspase (DRONC) (Dronc Fly)
Tags6x HISExpressionBacterialPromoterT7Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
B. thetaiotaomicron 16S toehold switch sensor
Plasmid#110697PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. thetaiotaomicron 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
A1-20B1(P004)
Plasmid#184056PurposeThis plasmid carries Yn situ preamplifier A1-20B1 sequence and is used for nickase based synthesis.DepositorInsertA1-20B1 preamplifier
UseSynthetic BiologyAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-mGFP-pA(AV222)
Plasmid#117858PurposeThis plasmid expresses membrane anchored GFP to facility axon morphology study.DepositorInsertmGFP
UseAdenoviralExpressionMammalianPromoterCMVAvailable SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
tetO-Bcl2-IRES-tdtomato(TET005)
Plasmid#117857PurposeThis plasmid expresses Bcl2 under the activation of tTA trans-activator along with fluorescent marker tdTomato.DepositorAvailable SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
A1-20B1 (P001)
Plasmid#161820PurposeThis plasmid carries Yn situ preamplifier A1-20B1 sequence.DepositorInsertA1-20B1
UseSynthetic BiologyAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-Kir2.1-pA-CMV-mRFP-pA(AV39)
Plasmid#117856PurposeThis plasmid expresses Kir2.1 along with fluorescent marker RFP under the control of CMV promoter. The vector also supports the construction of adenovirus using ADeasy system.DepositorAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only