-
Plasmid#182642PurposeMammalian expression vector encoding a protein fusion composed of an N-terminal ER targeting sequence of hemagglutinin (HA), followed by EGFP and murine CDMPR (without its signal peptide)DepositorInsertCDMPR
UseRetroviralTagsEGFP and N-terminal ER targeting sequence of hema…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-C3-10H-SIII
Plasmid#175444PurposeHiFi-compatible destination vector for secreted overexpression of 3C-cleavable, C-terminal 10His-TwinStrep tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneUseTags3C-10His-TwinStrep and BiP Secretion PeptideExpressionInsectMutationPromoterFused Actin-HSP70Available sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B7
Plasmid#135509PurposeMammalian expression of myc-tagged HLA-B*07:02DepositorInsertHLA-B*07:02 (HLA-B Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D BARK p2A mCherry
Plasmid#117691PurposeGfaABC1D-iBARK-p2A-mCherry: Viral expression vector for astrocyte Gaq silencingDepositorInsertBARKrgs peptide
UseAAVTagsHA / FLAGExpressionMutationPromoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2
Plasmid#135504PurposeMammalian expression of myc-tagged HLA-A*02:01DepositorInsertHLA-A*02:01 (HLA-A Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG FLEX BARK p2A mCherry
Plasmid#117693PurposeCAG-FLEx-iBARK-p2A-mCherry: Viral expression vector for Cre-dependent Gaq silencingDepositorInsertBARKrgs peptide
UseCre/LoxTagsHA / FLAGExpressionMutationPromoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYCN_P2A_Hygro_Barcode
Plasmid#120463PurposeBarcoded lentiviral vector to express MYCN in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYCN (MYCN Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV9retro
Plasmid#224687PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap9retro
UseAAVTagsExpressionMutationinsertion of 10-mer peptide from AAV2retro (LADQD…PromoterAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
anti-FLAG M2 heavy chain
Plasmid#175359PurposeMammalian expression vector for over-expression of anti-FLAG M2 heavy chain (C-terminal His8)DepositorInsertanti-FLAG M2 heavy chain
UseTagsHis8 tag and N-terminal secretion signal peptide …ExpressionMammalianMutationL51I (see paper)PromoterCMVAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
8522-M01-663
Plasmid#225660PurposeLentiviral expression of a cancer stem cell reporter that responds to presence of Sox2/Oct4 or their paralogs (green configuration)DepositorInsertdsCopGFP
UseLentiviralTagsExpressionMutationPromoterSORE6-mCMVpAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
OPRM1-DuET
Plasmid#213361PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertOPRM1 (OPRM1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-MYCN
Plasmid#104542PurposePiggyBac vector encoding doxycycline-inducible human MYCNDepositorInsertMYCN proto-oncogene, bHLH transcription factor (MYCN Human)
UseTagsExpressionBacterial and MammalianMutationPromoterTRE3GAvailable sinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-Cre-2A-mCherry-FKF
Plasmid#119868PurposeDonor cassette containing NLS-tagged Cre, a Thosea asigna virus peptide (2A), mCherry and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertNLS-Cre, 2A, mCherry and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
UseTagsmCherryExpressionBacterialMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
P2RY11-DuET
Plasmid#213364PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertP2RY11 (P2RY11 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR
Plasmid#135500PurposeMammalian expression of FLAG-tagged TAPBPRDepositorInsertTAPBPR (TAPBPL Human)
UseTagsLuminal FLAG epitope tag and Signal peptide from …ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 1475 (pLenti-BLAST-GATA4-P2A-H2A-mCherry)
Plasmid#233549PurposeA CMV driven human GATA4 followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorInsertGATA4 (GATA4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI-Caspase 1
Plasmid#41552DepositorInsertCaspase-1 (CASP1 Human)
UseTagsMycExpressionMammalianMutationPromoterCMV immediate-early enhancer/promoterAvailable sinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianMutationPromoterCbhAvailable sinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-AP-Sstr3-GFP-DEST
Plasmid#49098PurposeExpressing AP-Sstr3-GFP in mammalian cells, can be used for establishing Flp-In stable cell linesDepositorInsertSstr3 (Sstr3 Mouse)
UseTagsGFP and acceptor peptide (AP)ExpressionMammalianMutationPromoterT7Available sinceNov. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HA-Flag-natT1R2
Plasmid#113944Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutininDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839PromoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
UseTags(His)6 and EGFPExpressionMammalianMutationPromoterCMVAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-AP-Smo-YFP-DEST
Plasmid#49099PurposeExpressing AP-Smo-YFP in mammalian cells, can be used for establishing Flp-In stable cell linesDepositorInsertSmo (Smo Mouse)
UseTagsYFP and acceptor peptide (AP)ExpressionMammalianMutationPromoterT7Available sinceNov. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
OPN3-DuET
Plasmid#213357PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertOPN3 (OPN3 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ICMAB - pET22b T7 EncFtn Mms6
Plasmid#225538PurposeConstruction of intracellular magnetite accumulating bacterial systems.DepositorInsertsIron binding protein
Ferroxidase
Material binding peptite
Iron transporter protein
UseTagsnoExpressionBacterialMutationPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASP
Plasmid#111585PurposeAn AAV vector that expresses double floxed myristoylated iRFP670 with V5 tag and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyriRFP670V5-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV BARK D110A p2A mCherry
Plasmid#117690PurposeCMV-iBARK(D110A)-p2A-mCherry: Negative control mammalian expression vector for Gaq silencingDepositorInsertBARKrgs D110A peptide
UseTagsHA / FLAGExpressionMammalianMutationD110APromoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mCerulean3-P2A-mKOFP2-CAAX
Plasmid#75154PurposeNuclear mCerulean2 (blue) fluorophore and a membrane targeted KOFP2 (orange) fluorophore separated by a self-cleaving 2A peptide for use with 5’ promoters.DepositorInsertH2B-mCerulean3-P2A-mKOFP2-CAAX
UseMiddle entry vector for multisite gateway three f…TagsExpressionMutationPromotern/aAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpyDock
Plasmid#124618PurposeExpresses SpyDock to bind SpyTag non-covalently for affinity purificationDepositorInsertSpyDock
UseTagsHis6ExpressionBacterialMutationE77A mutation prevents isopeptide bond formation,…PromoterT7Available sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
HMBP-3C-STAR.66-285
Plasmid#100094Purposeexpresses MBP-tagged STARD1 protein domain (residues 66-285)DepositorInsertSTAR protein (STAR Human)
UseTagsHis-tagged MBPExpressionBacterialMutationPromoterPtacAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
MET7A-CD4d3+4-bio
Plasmid#73127PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding MET7A with rat CD4d3+4-bioDepositorInsertMET7A (METTL7A Human)
UseTagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
SSTR3-DuET
Plasmid#213378PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertSSTR3 (SSTR3 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT2-4xUAS:P2A-mCerulean3
Plasmid#127592PurposeThis vector is used for cloning a gene driven by 4xnrUAS, to be co-expressed with mCerulean3 through P2A self-cleaving peptides.DepositorTypeEmpty backboneUseZebrafish expressionTagsExpressionMutationPromoterAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-T2A-Venus(L68V)
Plasmid#60494PurposeProduces equimolar levels of mTurquoise2 and mVenus(L68V). It can be used as a negative control for FRET.DepositorInsertmTurquoise2-T2A-mVenus(L68V)
UseTagsT2A peptideExpressionMammalianMutationPromoterCMVAvailable sinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFlag IFIT3
Plasmid#53553Purposemammalian expression of IFIT3DepositorInsertIFIT3 (IFIT3 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterCMVAvailable sinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYSD313
Plasmid#212931PurposeEncodes the Aga2 signal peptide, mRuby2 fluorescent protein HA-tagged Sed1p yeast surface display anchor protein with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertSed1 (SED1 Budding Yeast)
UseTagsExpressionYeastMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Activin A (S2-2)
Plasmid#184621Purposefor transfection into S2 cells and expression of Activin A proteinDepositorInsertINHBA (INHBA Human)
UseTags8x His - streptavidin binding peptideExpressionInsectMutationPromoterAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBJ FLAG-hPar1
Plasmid#53226Purposemammalian expression of human Par1 with N-terminal FLAG tagDepositorInsertPar1 (F2R Human)
UseTagsFLAG and bovine prolactin signal sequence (MDSKGS…ExpressionMammalianMutationDeletion of aa1-39 (native signal peptide)PromoterSV40Available sinceAug. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422gp140-TM
Plasmid#123251PurposeMammalian expression plasmid for soluble gp140 from the DU422 HIV-1 isolate with a transmembrane tetherDepositorInsertHIV-1 (DU422) Env
UseTagsCD5 leader peptide and Linker (with 6his tag) and…ExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
NTSR1-DuET
Plasmid#213356PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertNTSR1 (NTSR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSTR2-DuET
Plasmid#213377PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertSSTR2 (SSTR2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His hTFNG
Plasmid#67240PurposeExpresses N-His tagged nonglycosylated human serum transferrin in mammalian cellsDepositorInserthuman serum transferrin (TF Human)
UseTagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationAsn413 Asp, Asn611AspPromoterSV40Available sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-RBP-LOV2
Plasmid#185792PurposeEncodes Light-oxygen-voltage-sensing domain 2 linked to RNA binding peptide (on N terminal end) via GS-linkerDepositorInsertRBP-LOV2
UseTags10xHis, TEV protease cleavage site after His TagExpressionBacterialMutationPromoterT7Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
SWEET11:SWEET11-2A-GFP-GUS
Plasmid#172484PurposeTranslational fusion of SWEET11 with a P2A self cleaving peptide sequenceDepositorInsertSWEET11 (AT3G48740 Mustard Weed)
UseTagsGFP, GUSExpressionPlantMutationPromoterSWEET11Available sinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ173
Plasmid#99907PurposeExpress CRISPR-Act2.0 system which contains pco-dCas9-VP64 fusion protein and MS2-VP64 fusion protein linked by in-frame T2A (encoding Thosea asigna 'self-cleaving' 2A peptide) sequenceDepositorInsertpco-dCas9-VP64-T2A-MS2-VP64
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b-HRASLS3-1-132
Plasmid#100725PurposeExpression of N-terminal region of human HRASLS3 in E.coliDepositorInsertHRASLS3 (PLAAT3 Human)
UseTagsHisExpressionBacterialMutationPromoterT7 promotorAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-SV40 polyA signal
Plasmid#48627PurposeContributes a cassette containing an SV40 polyA signal as the 3’-module during MultiSite Gateway cloning of chimeric cDNAs, when a peptide module at the C-terminal end is not required.DepositorInsertSV40 early polyadenylation signal cassette
UseGateway entry vectorTagsExpressionMutationPromoternoneAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
MTNR1A-DuET
Plasmid#213348PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertMTNR1A (MTNR1A Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only