We narrowed to 4,405 results for: pes
-
Plasmid#192404PurposeOn state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its B3RT sites.DepositorInsertB3RT-Act2-B3RT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP756_L2pV1_NOT_B3RT_Rluc_1IB_lacZ
Plasmid#192401PurposeOff state for the first generation of NOT gates, which target the Rluc CDS to repress expression via its B3RT sites.DepositorInsertAct2::B3RT-Rluc-B3RT
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP755_L2pV1_NOT_B3RT_Rluc_0I_lacZ
Plasmid#192400PurposeOn state for the first generation of NOT gates, which target the Rluc CDS to repress expression via its B3RT sites.DepositorInsertAct2::B3RT-Rluc-B3RT
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP714_L2pV3_NOT_FRT_Rluc_0I_lacZ
Plasmid#192402PurposeOn state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its FRT sites.DepositorInsertFRT-Act2-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP758_L2pV3_NOT_B3RT_Rluc_1IB_lacZ
Plasmid#192405PurposeOff state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its B3RT sites.DepositorInsertB3RT-Act2-B3RT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP713_L2pV3_NOT_FRT_Rluc_1IF_lacZ
Plasmid#192403PurposeOff state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its FRT sites.DepositorInsertFRT-Act2-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP738_L2pV1_1I_Act2_FRT_OCS_s35S_Flp_lacZ
Plasmid#192381PurposeTo test if the 35S promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP736_L2pV1_1I_Act2_FRT_OCS_TCTP_Flp_lacZ
Plasmid#192379PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output (despite the presence of the lacZ endlinker).DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP734_L2pV1_1I_OCS-rLUC_F-NOS-FlpO
Plasmid#192377PurposeTo test if the NOS promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP735_L2pV1_1I_OCS-rLUC_F-TCTP-FlpO
Plasmid#192378PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9339 (pgRNA_VII-1_NatMX)
Plasmid#161591PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9340 (pgRNA_VIII-1_NatMX)
Plasmid#161592PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW927
Plasmid#115961PurposeORF insert for replicon MoCloDepositorInsertLvl0 ORF TetR-2A-mKate-PEST GG
UseSynthetic BiologyAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
OpenLoopControl
Plasmid#59895Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Does not contain the target containing Vamp3 3′UTRDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPESTExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-LUC2CP/ARE
Plasmid#62857PurposeSplicing reporter control (no intron) with elements to shorten the half-life of the luciferase protein as well as the luciferase mRNA.DepositorInsertLuciferase
UseLuciferaseExpressionMammalianMutationdestabilizing sequences (DS) added to the C termi…PromoterCMVAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2mRFP1
Plasmid#239991PurposeDestabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activationDepositorInsertsmRFP1
PEST
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5179
Plasmid#239358PurposeExrpession of Rice TIR1 F74->G, Rice ARF fragment and blaticidin resistance by read through transaction after integration int the PFR1 locusDepositorInsertRice TIR1, Rice ARF16 and blasticidin resistance
UseBacterialTagsTIR1 and ARF are both Ty-epitope taggedMutationTIR1 F74->G. ARF16 is residues 784 to 959 onlyPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-NLS-CBRed-d2-hygro
Plasmid#139196Purposenon-ERK dependent control plasmid for pMSCV-NLS-CBGreen-FIRE-puroDepositorInsertCBRed
UseLuciferase and RetroviralTagsd2 PEST domain and nuclear localization signal (N…ExpressionMammalianAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMX IkB alpha M
Plasmid#12329DepositorInsertIkB alpha M (Nfkbia Mouse)
ExpressionMammalianMutationDominant-negative mutant. Many signal transductio…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMVhPOP1_3Flag
Plasmid#53968PurposeMammalian expression vector for human POP1 with c-terminal 3xFLAG epitopes.DepositorAvailable SinceJuly 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC-] (AVA2515)
Plasmid#85443PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1836
Plasmid#154337PurposePromoter reporterDepositorInsertSV40 NLS::mScarlet_I::PEST (dpi)::-tbb-2 3'UTR
ExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLXSN IkB alpha M
Plasmid#12330DepositorInsertIkB alpha M (Nfkbia Mouse)
UseRetroviralExpressionMammalianMutationDominant-negative mutant. Many signal transductio…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-AD8-QES.i08.c04
Plasmid#123259PurposeMammalian expression plasmid for Env from the AD8 HIV-1 isolate; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (AD8) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Mutations P124D, …PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT (PGK) 5xGRE-NanoLuc
Plasmid#207170PurposeGAl4 response element driven NanoLuc Lentiviral reporterDepositorInsertsNanoLuciferase
d2eGFP
5x GRE
UseLentiviral, Luciferase, and Synthetic BiologyTags3x SV40 NLS and PESTPromoterGal4 response element minP and PGKAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgFFL
Plasmid#59877Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP955
Plasmid#239877PurposeTCTP-SynPro-08 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-08::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP956
Plasmid#239878PurposeTCTP-SynPro-09 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-09::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP957
Plasmid#239879PurposeTCTP-SynPro-10 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-10::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP958
Plasmid#239880PurposeTCTP-SynPro-11 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-11::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP953
Plasmid#239875PurposeTCTP-SynPro-06 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-06::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP954
Plasmid#239876PurposeTCTP-SynPro-07 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-07::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP967
Plasmid#239889PurposeCaMV 35S-SynPro-02 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-02::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP965
Plasmid#239887PurposeWild type CaMV 35S promoter engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP966
Plasmid#239888PurposeCaMV 35S-SynPro-01 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-01::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP968
Plasmid#239890PurposeCaMV 35S-SynPro-03 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-03::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP969
Plasmid#239891PurposeCaMV 35S-SynPro-04 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-04::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP970
Plasmid#239892PurposeCaMV 35S-SynPro-05 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-05::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP977
Plasmid#239899PurposeCaMV 35S-SynPro-12 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-12::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only