We narrowed to 4,666 results for: GCA
-
Plasmid#76807Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
NRBP2 gRNA (BRDN0001145030)
Plasmid#76455Purpose3rd generation lentiviral gRNA plasmid targeting human NRBP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ULK4 gRNA (BRDN0001145110)
Plasmid#76009Purpose3rd generation lentiviral gRNA plasmid targeting human ULK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYLK3 gRNA (BRDN0001148087)
Plasmid#75950Purpose3rd generation lentiviral gRNA plasmid targeting human MYLK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK1 gRNA (BRDN0001148112)
Plasmid#75965Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK16 gRNA (BRDN0001145107)
Plasmid#75935Purpose3rd generation lentiviral gRNA plasmid targeting human STK16DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001145731)
Plasmid#75533Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001147018)
Plasmid#75535Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STRADB gRNA (BRDN0001148940)
Plasmid#75496Purpose3rd generation lentiviral gRNA plasmid targeting human STRADBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-super TEV protease
Plasmid#171782PurposeExpresses Maltose-binding protein-super TEV protease in bacterial cytoplasm. This protease version performs well in the absence of added reducing agent.DepositorInsertMBP-sTEV
TagsArg6 tag and Internal His6 tagExpressionBacterialMutationNo internal TEV cleavage site between the MBP and…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
TP53-KO_gRNA_2
Plasmid#195131PurposeTP53-targeting gRNA in the LRG2.1 backboneDepositorInsertTP53 KO gRNA 2 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shSNAI1
Plasmid#115467PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001148452)
Plasmid#75943Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMKV gRNA (BRDN0001145768)
Plasmid#75526Purpose3rd generation lentiviral gRNA plasmid targeting human CAMKVDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3K gRNA (BRDN0001148047)
Plasmid#77433Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only