We narrowed to 11,471 results for: AGA
-
Plasmid#244975PurposeExpresses a fusion protein of a nanobody against integrin alpha M (ITGAM; CD11b) and peroxidase (POD) in mammalian cellsDepositorInsertITGAM POD-nAb
Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL22-sgRNANT1-KmR
Plasmid#73224PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL22-sgRNA NT1
ExpressionBacterialPromoterPL22Available SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSico-shNKCC1
Plasmid#83027Purposeexpresses an shRNA against NKCC1DepositorInsertshNKCC1
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGWB501NL3F10H
Plasmid#141286PurposeNo promoter, C-terminal NLUC:3xFlag:10xHis tag, attR1-Cmr-ccdB-attR2-NLUC:3xFlag:3xHis-TNOS (modified pGWB401, pPZP backbone, SpcR for bacteria, HygR for plant)DepositorTypeEmpty backboneUseLuciferase; GatewayTagsFLAG (x3), HIS (x10), and NLUCExpressionPlantAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Rheb1 shRNA #2
Plasmid#26626DepositorAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJYS2cm_crtYf
Plasmid#85543PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-HDAC1-shRNA2
Plasmid#90241PurposeLentivirus for expression of shRNA2 against human HDAC1 (Dox-inducible)DepositorInsertHDAC1 (HDAC1 Human)
UseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-HDAC1-shRNA1
Plasmid#90242PurposeLentivirus for expression of shRNA1 against human HDAC1 (Dox-inducible)DepositorInsertHDAC1 (HDAC1 Human)
UseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E-csGBP
Plasmid#108891PurposeMultisite gateway vector for 3' tagging with a conditionally stable nanobody against GFPDepositorInsertcsGBP
UseMultisite gatewayAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only