169,450 results
-
Plasmid#184734PurposeCOX2-KO in HeLaDepositorInsertA gRNA targeting the human COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-mCherry-WPRE-UbC-Emerald
Plasmid#211797PurposeLentiviral vector plasmid expressing mCherry under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsmCherry
Emerald
UseLentiviralExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgRELA guide 1
Plasmid#193591PurposeRELA knockoutDepositorInsertsgRELA guide 1 (RELA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkB2 guide 1
Plasmid#193593PurposeNFkB2 knockoutDepositorInsertsgNFkB2 guide 1 (NFKB2 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-somBiPOLES-mKate2
Plasmid#192579PurposeAAV-vector for bidirectional optogenetic manipulation of tTA-positive neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterTRE3GVAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#2
Plasmid#170838PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#3
Plasmid#170839PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#1
Plasmid#170837PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX026
Plasmid#167153PurposeMoClo-compatible Level 1 (position 4) vector encoding Neonothopanus nambi luciferase nnLuz with C-terminal His-tag under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnLuz-ocsT
UseLuciferaseTagsHis6-tagExpressionPlantPromoterp35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only