We narrowed to 1,967 results for: RNAi
-
Plasmid#160210PurposeKnock Down MTLSH3- Collybistin isoformsDepositorAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only
-
CBSH3- shRNA3
Plasmid#160212PurposeKnock Down MYDSH3- Collybistin isoformsDepositorAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- shRNA1
Plasmid#160208PurposeKnock Down MQWSH3- Collybistin isoformsDepositorAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
shAPI5#2
Plasmid#157666PurposeTet inducible knockdown of API5DepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
shAPI5#1
Plasmid#157665PurposeTet inducible knockdown of API5DepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (EGFP) shPnky-2
Plasmid#79142PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of CreDepositorInsertshPnky-2 (Gm30731 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for the shRNA and CMV for EGFPAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.3
Plasmid#46682PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.3 (MIR16-1 Human, Synthetic)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.1
Plasmid#46680PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.1 (MIR16-1 Human, Synthetic)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L1-L4
Plasmid#62136PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA R4-R3
Plasmid#62137PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L5-L2
Plasmid#62139PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR 7SK-miR-30 R4-R3
Plasmid#62121PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a 7SK RNA polymerase III promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR 7SK-miR-30 L1-R5
Plasmid#62118PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a 7SK RNA polymerase III promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA6
Plasmid#59310PurposeKnockdown of human FOXH1DepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to bulged siRNA
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pre-associated oBC-mBC backbone (p025)
Pooled Library#194097Purposepre-associated oBC-mBC backbone (p025), can insert additional reporter constructsDepositorExpressionBacterial and MammalianUseRNAiAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
scQers promoter control #2 (low: no promoter, p029)
Pooled Library#217421PurposescQers promoter control #2 (low: no promoter, p029)DepositorExpressionBacterial and MammalianUseRNAiAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only