We narrowed to 7,749 results for: lentivirus vector
-
Plasmid#213772PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT2_mCherry2-NLS-PEST_Puro
Plasmid#213769PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT2_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT2_short_mCherry2-NLS-PEST_Puro
Plasmid#213770PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT2_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT1_mCherry2-NLS-PEST_Puro
Plasmid#213767PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT1_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT1_short_mCherry2-NLS-PEST_Puro
Plasmid#213768PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT1_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-AERRIE
Plasmid#204023PurposeLentiviral vector expressing human long non-coding RNA AERRIE (linc01013)DepositorAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-Llgl1-WPRE-UbC-Emerald
Plasmid#203805PurposeLentiviral vector plasmid expressing mouse Llgl1 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_SFFV*/Puro2a-PAG1-GFP
Plasmid#198223PurposeLentiviral plasmid derived from pHR_SFFV (Addgene #79121) expressing cDNA for a codon-optimized puromycin resistance gene, followed by an FMDV 2A domain and then EGFPDepositorInsertPAG1 (PAG1 Human)
UseLentiviralTagsFollowed by EGFP, after a flexible linker and Pre…ExpressionMammalianMutationNoneAvailable sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-LASSIE
Plasmid#192105PurposeLentiviral vector expressing long non-coding RNA LASSIE (linc00520)DepositorInsertLASSIE
UseLentiviralPromoterCMVAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP229-Lenti-TRE3G-4xMyc-GluN2B-WPRE-pA
Plasmid#164794PurposepLenti vector backbone designed to express 4XMyc Tagged-GluN2B from a TRE3G promoter.DepositorInsertGluN2B
UseLentiviralTags4xMycAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP231-Lenti-TRE3G-Flag-GluN2B(E1479Q)-WPRE-pA
Plasmid#164796PurposepLenti vector backbone designed to express Flag Tagged-GluN2B(E1479Q) from a TRE3G promoter.DepositorInsertGluN2B
UseLentiviralTagsFlagAvailable sinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP226-Lenti-CMV-Flag-GluN2B-WRPE-pA
Plasmid#84275PurposepLenti vector backbone designed to express Flag-GluN2B from a CMV promoter.DepositorInsertGluN2B
UseLentiviralTagsFlagPromoterCMVAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP209-Lenti-1.3CaMKII P-Intron-Flag-GluN2A-WPRE-pA
Plasmid#74714PurposepLenti vector backbone designed to express Flag-GluN2A from a 1.3CaMKII promoter. Transgene in reverse orientation.DepositorInsertFlag-GluN2A
UseLentiviralTagsFlagPromoter1.3CaMKIIaAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαS97A-IRES-EGFP
Plasmid#183457PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97A variantDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαS97E-IRES-EGFP
Plasmid#183458PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97E variantDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP225-Lenti-CMV-Flag-GluN2A-WPRE-pA
Plasmid#84274PurposepLenti vector backbone designed to express Flag-GluN2A from a CMV promoter.DepositorInsertFlag-GluN2A
UseLentiviralTagsFlagPromoterCMVAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only