We narrowed to 24,339 results for: FUS
-
Plasmid#135988PurposeExpresses the PYL1 abscisic acid-inducible domain fused to the VPR transcriptional activation domain in mammalian cellsDepositorInsertPYL1 domain fused to the VPR activation domain
TagsHisExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-VdC9BV
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)Available SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ADARcd-YTHD422N
Plasmid#194402PurposeADAR1 catalytic domain E488Q fused to YTHD422NDepositorInsertADARcd fused to YTHD422N (ADAR Human)
TagsADARcd-YTHD422N-HAExpressionMammalianMutationD422N mutation in the YTH domain to enhance m6A b…Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLGCV
Plasmid#49862PurposeExpression in Caenorhabditis elegans of the luc+ gene (Promega), fused in frame to GFP (S65C), under the sur-5 promoter (from plasmid pTG96, John Yochem and Min Han). Backbone pPD95.79 (Firelab).DepositorInsertfirefly luciferase luc+ fused to GFP (S65C)
TagsGFP (S65C)ExpressionWormPromotersur-5Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
GAG-PEmax V7
Plasmid#232921PurposeOptimized construct for the expression of PEmax fused to GAG from fMLV. This plasmid is involved in the production of NanoScribesDepositorInsertGAG FMLV fused to PEmax
UseCRISPRTagsNuclear export signals (x3)ExpressionMammalianAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDT386
Plasmid#174733PurposeExpresses His-tagged DT386, a truncated diphtheria toxin without a receptor-binding domain.DepositorInsertDT386
TagsHistagExpressionBacterialMutationDeleted amino acids 412-560 (the receptor binding…PromoterT5Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
mRFP-mem
Plasmid#55622PurposeThis red fluorescent plasma membrane marker consists of the first twenty residues of neuromodulin fused to mRFP.DepositorInsertmRFP-Mem
TagsThe N-terminal 20 residues of neuromodulin are fu…ExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP3
Plasmid#160086PurposeBacterial expression of Tn5-APEX2 fusion protein with linker AEAAAKEAAAKADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only