We narrowed to 2,589 results for: GCG
-
Plasmid#228940PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pGL3-Ctr1-gRNA-EGFP
Plasmid#226000PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr2-gRNA-EGFP
Plasmid#226001PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA1-EGFP
Plasmid#226004PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SOX2_HDR
Plasmid#163752PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.DepositorAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DHX58-ts3
Plasmid#174246PurposeDHX58 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g2
Plasmid#170827PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-SPNS1-sg2
Plasmid#198567PurposeSPNS1-targeting sgRNA in PX458 vectorDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA242
Plasmid#215943PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v1 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7578 pHR (hU6-crPROX-EFS-PuroR-WPRE)
Plasmid#214882PurposeLentiviral vector encoding RfxCas13d targeting PROX guide arrayDepositorInserthU6-crPROX-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX3(13))-PGKpuro2ABFP-W
Plasmid#208552PurposeLentiviral vector expressing gRNA targeting human RUNX3DepositorInsertRUNX3(13) (RUNX3 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Control(1))-PGKpuro2AmCherry-W
Plasmid#210612PurposeLentiviral vector expressing gRNA targeting a control region at the CXCR4 locusDepositorInsertControl(1)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_1
Plasmid#210625PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_1
Plasmid#210621PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_4
Plasmid#210624PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only