We narrowed to 261 results for: aav vectors expressing gfp
-
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP
Plasmid#102935PurposeAn AAV vector that expresses rat NK1R-IRES-EGFP under the CMV-IE promoterDepositorAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorInsertGFP, sgHTT and sgCas9 (HTT Human)
UseAAV and CRISPRTagsExpressionMutationPromoterEFS and U6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-H2B-GFP-2A-oG-WPRE-hGH
Plasmid#74289PurposepAAV vector to express H2B-GFP and oG (optimized Glycoprotein) in a Cre-dependent mannerDepositorInsertH2B-GFP and oG (optimized Glycoprotein)
UseAAVTagsExpressionMammalianMutationchimeric glycoproteinPromoterEf1aAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianMutationPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-CAG-M2rtTA-H2BGFP (donor AB)
Plasmid#85798PurposedonorAB targeting vector for human AAVS1 locus; knock-in of Dox controlled H2BGFP expression systemDepositorInsertPPP1R12C (PPP1R12C Human)
UseHuman targetingTagsExpressionMutationhomology arms for knock-in into first intronPromoterAvailable SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
Plasmid#113158PurposeAn AAV vector that expresses a Cre-dependent guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV, CRISPR, and Cre/LoxTagsExpressionMammalianMutationPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianMutationPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalExpressionMutationPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{DTR-GFP}on-W3SL
Plasmid#111396PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation), and W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianMutationPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXJ220-pAAV-PB3'IR-U6-gRNA-EF1a-GFP-KASH-PB5'IR
Plasmid#213481PurposeAAV piggybac transposon vector, with GFP-KASH reporter and gRNA cloning site. Compatible with 10X 5' gRNA capture technology.DepositorInsertsGFP-KASH
U6-gRNA
UseAAVTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXJ197-pAAV-PB3'IR-U6-gRNA-directcapture-EF1a-GFP-KASH-PB5'IR
Plasmid#210523PurposeAAV piggybac transposon vector, with GFP-KASH reporter and gRNA cloning site. Compatible with 10X 3' and 5' gRNA capture technology.DepositorInsertsGFP-KASH
U6-gRNA-directcapture
UseAAVTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-H2GH
Plasmid#182202PurposeAdeno-associated viral vector to express histone2B-HaloTag-GFP fusion, a nuclear-localized Halotag-GFP fusion constructDepositorInserthistone2B-HaloTag-GFP
UseAAVTagsExpressionMutationPromoterAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only