We narrowed to 4,522 results for: ARA-2
-
Viral Prep#100054-AAV2PurposeReady-to-use AAV2 particles produced from pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 (#100054). In addition to the viral particles, you will also receive purified pAAV.CAG.hChR2(H134R)-mCherry.WPRE.SV40 plasmid DNA. CAG-driven, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmCherryAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-N1 hMOG-beta2-EGFP
Plasmid#160979PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta2 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Antibody#201865-rAbPurposeAnti-Desmin (Human) recombinant scFv-Fc-fusionDepositorRecommended ApplicationsELISAReactivityHumanSource SpeciesHumanIsotypeIgG1Trial SizeAvailable to purchaseAvailable SinceOct. 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
PB-TO-hNGN2
Plasmid#172115PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expressionInsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Antibody#241000-rAbPurposeAnti-Glypican 5 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human GPC5. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
ExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutati…Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Antibody#241001-rAbPurposeAnti-Glypican 6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC6. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
PB-TO-hNIL
Plasmid#172113PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expressionTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#240999-rAbPurposeAnti-Glypican 4 (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes mouse and human GPC4. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#240996-rAbPurposeAnti-Glypican 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; recognizes human and mouse GPC1. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceOct. 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV5)
Viral Prep#20297-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-ChR2-Venus-AAV (AAV1)
Viral Prep#20071-AAV1PurposeReady-to-use AAV1 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGGTagsVenusAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV9)
Viral Prep#20297-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-ChR2-Venus-AAV (AAV9)
Viral Prep#20071-AAV9PurposeReady-to-use AAV9 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGGTagsVenusAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV8)
Viral Prep#20297-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV1)
Viral Prep#20297-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV5)
Viral Prep#20298-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV9)
Viral Prep#20298-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV1)
Viral Prep#20298-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV Retrograde)
Viral Prep#20298-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180085-rAbPurposeAnti-Arl13b (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (AAV Retrograde)
Viral Prep#20297-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (#20297). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA plasmid DNA. Humanized channelrhodopsin H134R mutant fused to mCherry, driven by the EF1a promoter. Cre-dependent. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChR2(H134R)-GFP (AAV8)
Viral Prep#58880-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-ChR2(H134R)-GFP (#58880). In addition to the viral particles, you will also receive purified pAAV-Syn-ChR2(H134R)-GFP plasmid DNA. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV PHP.eB)
Viral Prep#20298-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Antibody#184210-rAbPurposeAnti-PSD-93/Chapsyn-110 (Rat) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceAug. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV_BiSSTe4_ChR2_mCherry (AAV1)
Viral Prep#213945-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe4_ChR2_mCherry (#213945). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_ChR2_mCherry (AAV1)
Viral Prep#213856-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiVIPe4_ChR2_mCherry (#213856). In addition to the viral particles, you will also receive purified pAAV_BiVIPe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the VIP interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_ChR2_mCherry (AAV1)
Viral Prep#213830-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiCHATe27_ChR2_mCherry (#213830). In addition to the viral particles, you will also receive purified pAAV_BiCHATe27_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the cholinergic neuron-targeting enhancer E27. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_ChR2_mCherry (AAV1)
Viral Prep#213941-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe3_ChR2_mCherry (#213941). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the PV+ basket cell-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_ChR2_mCherry (AAV1)
Viral Prep#213937-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe4_ChR2_mCherry (#213937). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the chandelier cell-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry (AAV1)
Viral Prep#213915-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_ChR2_mCherry (#213915). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe10_ChR2_mCherry (AAV1)
Viral Prep#213815-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe10_ChR2_mCherry (#213815). In addition to the viral particles, you will also receive purified pAAV_BiSSTe10_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E10. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP (AAV2)
Viral Prep#124364-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-FLEX-DTR-GFP (#124364). In addition to the viral particles, you will also receive purified pAAV-FLEX-DTR-GFP plasmid DNA. CBA-driven, Cre-dependent expression of DTR-GFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterChicken B-actinTagsGFP (Cre-dependent)Available SinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChR2(H134R)-GFP (AAV Retrograde)
Viral Prep#58880-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Syn-ChR2(H134R)-GFP (#58880). In addition to the viral particles, you will also receive purified pAAV-Syn-ChR2(H134R)-GFP plasmid DNA. Humanized channelrhodopsin H134R mutant fused to GFP, under the control of the Synapsin promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180105-rAbPurposeAnti-SynCAM4 (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV_BiSSTe4_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213945-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiSSTe4_ChR2_mCherry (#213945). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213856-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiVIPe4_ChR2_mCherry (#213856). In addition to the viral particles, you will also receive purified pAAV_BiVIPe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the VIP interneuron-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe10_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213815-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiSSTe10_ChR2_mCherry (#213815). In addition to the viral particles, you will also receive purified pAAV_BiSSTe10_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E10. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213941-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe3_ChR2_mCherry (#213941). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the PV+ basket cell-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213830-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiCHATe27_ChR2_mCherry (#213830). In addition to the viral particles, you will also receive purified pAAV_BiCHATe27_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the cholinergic neuron-targeting enhancer E27. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213937-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe4_ChR2_mCherry (#213937). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the chandelier cell-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213915-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiLAMP5e3_ChR2_mCherry (#213915). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.iGABASnFR (AAV1)
Viral Prep#112159-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSynap.iGABASnFR (#112159). In addition to the viral particles, you will also receive purified pAAV.hSynap.iGABASnFR plasmid DNA. Synapsin-driven iGABASnFR GABA sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (AAV5)
Viral Prep#111568-AAV5PurposeReady-to-use AAV5 particles produced from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (#111568). In addition to the viral particles, you will also receive purified pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid DNA. GfaABCD1-driven, expression of mCherry fused plasma membrane calcium pump hPMCA2w/b. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn-FLEX.iGABASnFR.F102G (AAV1)
Viral Prep#112164-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn-FLEX.iGABASnFR.F102G (#112164). In addition to the viral particles, you will also receive purified pAAV.hSyn-FLEX.iGABASnFR.F102G plasmid DNA. Synapsin-driven, Cre-dependent iGABASnFR.F102G GABA sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn-FLEX.iGABASnFR (AAV1)
Viral Prep#112163-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.hSyn-FLEX.iGABASnFR (#112163). In addition to the viral particles, you will also receive purified pAAV.hSyn-FLEX.iGABASnFR plasmid DNA. Synapsin-driven, Cre-dependent iGABASnFR GABA sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only