We narrowed to 120,450 results for: CIL
-
Plasmid#143535PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA5FRT/TO-PNGase-Strep-HA
Plasmid#113490PurposeExpression of human PNGase with C-terminal strep-HA tagDepositorInsertPNGase (NGLY1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFudioFRTPSD-95TealW
Plasmid#134299PurposeExpresses PSD95 fused to Teal fluorescent protein upon coexpression with the recombinase flippase (Flp)DepositorInsertPSD-95-Teal (Dlg4 Mouse, Rat)
UseLentiviral; Flp/frtTagsTealExpressionMammalianPromoterUbCAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNme2Cas9-NLS(SV40)-3xFLAG (KAC582)
Plasmid#134331PurposeCAG promoter expression plasmid for human codon optimized Nme2Cas9 nuclease with C-terminal NLS (SV40) and 3x FLAG tagDepositorInserthuman codon optimized Nme2Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-baPrs-hdNadV
Plasmid#91950PurposepET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyiDepositorInsertsPutative Nicotinamide Phosphoribosyl Transferase (nadV Haemophilus ducreyi, strain: ATCC 27722)
Phosphoribosyl Pyrophosphate Synthetases
ExpressionBacterialMutationchanged Leucine 135 to IsoleucinePromoterT7Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-PLAA-Strep-HA
Plasmid#113484PurposeExpression of human PLAA with C-terminal strep-HA tagDepositorInsertPLAA (PLAA Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT3035
Plasmid#122543PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a nuclear lamin localized gene (lmn-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 HGV-mRuby3
Plasmid#179227Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreen and mRuby3ExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-RTP1S-Integration
Plasmid#129458PurposepiggyBac transposon vector that Inducibly (Tet-On) expresses RTP1SDepositorInsertRTP1 (Rtp1 Mouse)
UseSynthetic BiologyExpressionMammalianMutationRemoval of the first 36 amino acids of the proteinPromoterTRE (Tet-On)Available SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST NET1A V5 WT
Plasmid#69817PurposeExpresses NET1A-V5 in mammalian cellsDepositorAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-YOD1-Strep-HA
Plasmid#113483PurposeExpression of human YOD1 with C-terminal strep-HA tagDepositorInsertYOD1 (YOD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF1667
Plasmid#143534PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1671
Plasmid#142822PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-AIRAPL-Strep-HA
Plasmid#113489PurposeExpression of human AIRAPL with C-terminal strep-HA tagDepositorInsertAIRAPL (ZFAND2B Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFB-Puro-A
Plasmid#192506PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a nd a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInserthU6-sgRNA-CS1-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterhU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFB-Puro-B
Plasmid#192507PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInsertbU6-sgRNACR2-CS-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterbU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hSt3Cas9-NLS(SV40)-3xFLAG (KAC426)
Plasmid#133788PurposeCAG promoter expression plasmid for human codon optimized St3Cas9 nuclease with C-terminal NLS (SV40)DepositorInserthuman codon optimized St3Cas9
TagsNLS(SV40)-3xFLAGExpressionMammalianMutationn/aPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only