We narrowed to 7,645 results for: Ski;
-
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro
Plasmid#89992PurposeDonor template for generation of OCT4-T2A-nEmGFP reporter cell linesDepositorAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MjACE2 (Pangolin)
Plasmid#158084PurposeExpresses pangolin ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-HsACE2 (human)
Plasmid#158081PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-mCherry-DMDEx23-eGFP
Plasmid#211366PurposePiggybac transposon plasmid for a DMD exon 23 skipping reporter (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23-eGFP
UseTagsExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCAGAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 Human, EMTB is human ensconsin; TurboID is engineered BirA from E.coli)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS D614G soluble Spike
Plasmid#164651PurposeExpresses SARS-CoV-2 soluble Spike protein with a D614G mutationDepositorInsertSARS-CoV-2 soluble spike (S SARS-CoV-2)
UseTagsHISExpressionMammalianMutationD614GPromoterCAGAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-SsACE2 (Pig)
Plasmid#158085PurposeExpresses pig ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-ClACE2 (Dog)
Plasmid#158083PurposeExpresses dog ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-RnACE2 (Rat)
Plasmid#158086PurposeExpresses rat ACE2 in mammalian cellsDepositorAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-FcACE2 (Cat)
Plasmid#158082PurposeExpresses cat ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Human ABeta-attR5
Plasmid#160436PurposeEntry vector for cloning human Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human)
UseTagsExpressionBacterialMutationPromoterAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES Puro
Plasmid#110343Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.DepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-axon-jYCaMP1s
Plasmid#135421PurposeAxon-targeted yellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVTagsGAP43 axon targeting sequenceExpressionMammalianMutationPromoterhSynAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only