We narrowed to 28,642 results for: SPR
-
Plasmid#75576Purpose3rd generation lentiviral gRNA plasmid targeting human NUAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
NUAK1 gRNA (BRDN0001162525)
Plasmid#75578Purpose3rd generation lentiviral gRNA plasmid targeting human NUAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKG1 gRNA (BRDN0001144981)
Plasmid#76356Purpose3rd generation lentiviral gRNA plasmid targeting human PHKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17B gRNA (BRDN0001146764)
Plasmid#76798Purpose3rd generation lentiviral gRNA plasmid targeting human STK17BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_ASCL1
Plasmid#64132PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_ASCL1
Plasmid#64131PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC147-pCR8-dCas9VP64
Plasmid#48219PurposedCas9VP64 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP64 activation domain
UseCRISPR; Gateway donorTagsHA Tag and VP64MutationD10A;H840AAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pVC297 VEGF Site#1
Plasmid#47505Purposehuman gRNA expression vector targeting VEGFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_5
Plasmid#74181Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVC228 VEGF Site#3
Plasmid#47507Purposehuman gRNA expression vector targeting VEGFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001147800)
Plasmid#76349Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-Cas9
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_1
Plasmid#74180Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK10 gRNA (BRDN0001162335)
Plasmid#75636Purpose3rd generation lentiviral gRNA plasmid targeting human NEK10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12/pSIR
Plasmid#61080PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorInsertgRNA_hIRF1 promoter #12 (IRF1 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6Available SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_IL1RN
Plasmid#64140PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_IL1RN
Plasmid#64151PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only