We narrowed to 14,267 results for: cas9
-
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA-UbC-eGFP-P2A-Bsr
Plasmid#83925PurposeLentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastRDepositorInsertseGFP
Bsr
UseCRISPR and LentiviralTagsP2APromoterhUbCAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pR26 GFP Dest
Plasmid#74283PurposeGene targeting vector for the mouse Rosa26 locus, including a loxP flanked stop cassette and GFP, for gateway cloningDepositorInsertRosa26 5-homology region
Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-8:TOMM20-mEGFP
Plasmid#87423PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TOMM20DepositorInsertTOMM20 Homology Arms with linker-mEGFP (TOMM20 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWS3799-gRNA-Csy4-template
Plasmid#182827PurposeSpCas9 gRNA-Csy4 templateDepositorInsertSpCas9 gRNA scaffold + Csy4 sequence
UseCRISPRAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Synthetic, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWalium20-10XUAS-3XFLAG-dCas9-VPR
Plasmid#78897PurposeExpresses 3XFLAG-dCas9-VPR (human codon) under 10XUAS control, for in vivo CRISPRaDepositorInsertdCas9-VPR
Tags3xFLAGExpressionInsectPromoter10XUASAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CjCas9-eGFP-HIF1a
Plasmid#137929PurposeExpression of cjCas9 with Hif1a targeting sgRNADepositorInsertCjCas9
UseAAV and CRISPRTagsSV40NLS-HA-T2A-EGFPPromoterEF-1alphaAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG/BFP Dest
Plasmid#74282PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette, BFP, for gateway cloningDepositorInsertRosa26 5-homology region
Available SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVX_DSB_Spectrum-V1
Plasmid#192474PurposeLentiviral DSB Spectrum V1 Reporter SystemDepositorInsertBFP1.2, incompleteGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
1137B=Hsp70Bb-Cas9
Plasmid#153284PurposeThe attB plasmid harboring the Hsp70Bb-Cas9-T2A-eGFP-p10 and a mini-white marker.DepositorInsertpHsp70Bb-SpCas9-T2A-eGFP-p10 (cas9 Synthetic)
UseCRISPRTagseGFPExpressionInsectPromoterDmel Hsp70BbAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS42H_PTEF1_dCas9_TCYC1
Plasmid#177155PurposeExpresses dCas9 in yeast cellsDepositorInsertNuclease-null Cas9
TagsSV40 NLSExpressionYeastPromoterTEF1 promoterAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_7_dCas9_HC_sgRNA
Plasmid#163711PurposeHigh copy plasmid with dCas9 and sgRNA expression cassettesDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX_DSB_Spectrum-V3
Plasmid#192476PurposeLentiviral DSB Spectrum V3 Reporter SystemDepositorInsertBFP1.2, mCherry, incompleteGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBECAb-apr
Plasmid#122001PurposeA cytidine deaminase-mediated base-editing plasmid in Acinetobacter baumanniiDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-Lambda2
Plasmid#104184PurposeLentiviral transfer vector that carries U6-driven non-targeting sgRNA using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-sgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only