We narrowed to 2,775 results for: SAB;
-
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Human, Aequorea victoria)
UseTagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationPromoterEF1α promoter (1.1kb short version)Available sinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55615PurposeAn amino-terminal CFP fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-1 (GNGT1 Bovine, Aequorea victoria)
UseTagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable sinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55616PurposeAn amino-terminal CFP fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP (1-158)-gamma-2 (Gng2 Aequorea victoria, Mouse)
UseTagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-10 in pcDNAI/Amp
Plasmid#55192PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-10. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP-(159-238)-gamma-10 (GNG10 Human, Aequorea victoria)
UseTagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-12 in pcDNAI/Amp
Plasmid#55194PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-12. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-12 (GNG12 Human, Aequorea victoria)
UseTagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable sinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X K181E
Plasmid#225714PurposeBacterial expression of USP27X (K181E) with GST tagDepositorInsertUSP27X K181E (USP27X Human)
UseTagsGSTExpressionBacterialMutationK181EPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro 3XFLAG-hATXN7L3
Plasmid#225725PurposeTransfection of ATXN7L3 with 3XFLAG tag in mammalian cellsDepositorInsertATXN7L3 (ATXN7L3 Human)
UseTags3XFLAGExpressionMammalianMutationPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X S404N
Plasmid#225724PurposeTransfection of USP27X (S404N) with HA tag in mammalian cellsDepositorInsertUSP27X S404N (USP27X Human)
UseTagsHAExpressionMammalianMutationS404NPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X Y381H
Plasmid#225723PurposeTransfection of USP27X (Y381H) with HA tag in mammalian cellsDepositorInsertUSP27X Y381H (USP27X Human)
UseTagsHAExpressionMammalianMutationY381HPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X F313V
Plasmid#225722PurposeTransfection of USP27X (F313V) with HA tag in mammalian cellsDepositorInsertUSP27X F313V (USP27X Human)
UseTagsHAExpressionMammalianMutationF313VPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X K181E
Plasmid#225721PurposeTransfection of USP27X (K181E) with HA tag in mammalian cellsDepositorInsertUSP27X K181E (USP27X Human)
UseTagsHAExpressionMammalianMutationK181EPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X Y144C
Plasmid#225720PurposeTransfection of USP27X (Y144C) with HA tag in mammalian cellsDepositorInsertUSP27X Y144C (USP27X Human)
UseTagsHAExpressionMammalianMutationY144CPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X G76S
Plasmid#225719PurposeTransfection of USP27X (G76S) with HA tag in mammalian cellsDepositorInsertUSP27X G76S (USP27X Human)
UseTagsHAExpressionMammalianMutationG76SPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X S404N
Plasmid#225717PurposeBacterial expression of USP27X (S404N) with GST tagDepositorInsertUSP27X S404N (USP27X Human)
UseTagsGSTExpressionBacterialMutationS404NPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X Y381H
Plasmid#225716PurposeBacterial expression of USP27X (Y381H) with GST tagDepositorInsertUSP27X Y381H (USP27X Human)
UseTagsGSTExpressionBacterialMutationY381HPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X F313V
Plasmid#225715PurposeBacterial expression of USP27X (F313V) with GST tagDepositorInsertUSP27X F313V (USP27X Human)
UseTagsGSTExpressionBacterialMutationF313VPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only