We narrowed to 7,413 results for: ESP
-
Plasmid#232088PurposeMammalian expression plasmid for ubiquibody (uAb) cloning backbone. Includes an Esp3I restriction site directly upstream of GSGSG linker and CHIPΔTPR CDS and a C-terminal IRES-mCherry cassette.DepositorInsertuAb with cloning Esp3I restriction site
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBI121-GFP-RmMYB108
Plasmid#173181PurposeExpresses Rosa multiflora MYB108 for subcellular localization in plantsDepositorInsertRmMYB108
ExpressionPlantAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_C_Myc_DDK_IRES_Puro_PRKRA_delta12
Plasmid#106116PurposeLentiviral expression of PRKRA delta 12DepositorAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
hSDH5
Plasmid#113046PurposeExpression of WT hSDH5DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
USH1CA1-TwinStrepII
Plasmid#83202PurposeExpression of tagged protein in mammalian cellsDepositorAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E174 Hs.PIK3R2-nostop
Plasmid#70458PurposeGateway ORF clone of human PIK3R2 [NM_005027.3] without stop codon (for C-terminal fusions)DepositorInsertPIK3R2 (PIK3R2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E157 Hs.PDGFRB
Plasmid#70441PurposeGateway ORF clone of human PDGFRB [NM_002609.3] with stop codon (for native or N-terminal fusions)DepositorInsertPDGFRB (PDGFRB Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E100 Hs.GRB2-nostop
Plasmid#70384PurposeGateway ORF clone of human GRB2 [NM_002086.4] without stop codon (for C-terminal fusions)DepositorInsertGRB2 (GRB2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-SS-113
Plasmid#68737PurposeZF9-TF with mCherry markerDepositorInsertsZF9-VP64
mCherry
TagsNLS and flagExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
slc6a3 probe
Plasmid#53764PurposecRNA probe to detect the slc6a3 transcriptDepositorInsertDAT
Available SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21a-hAIM2-His6
Plasmid#51532PurposeExpress His6-tagged hAIM2 in bacteriaDepositorAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28b-Rv2416c_wild
Plasmid#37649DepositorAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pBbAk-w4-loxP-TT-loxP-mCherry-PCB
Plasmid#228469PurposeFluorescent reporter for Cre recombinase activity and the PCB production gene. Cre removes a transcription terminator, leading to mCherry productionDepositorInsertsw4-loxP-TT-loxP-mCherry
Ho1
PcyA
ExpressionBacterialPromoterJ23106, J23108, and T7A1Available SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Zika NS5 RdRp
Plasmid#204788PurposeBacterial expression of Zika NS5 RdRpDepositorInsertZika NS5 RdRp domain
ExpressionBacterialAvailable SinceApril 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
trLATmEos3.2
Plasmid#203745PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GFP-2A-SynmRuby
Plasmid#166608PurposeEncodes Cre-dependent GFP-2A-synaptophysinmRuby under control of the TREDepositorInsertGFP-2A-syn
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only