-
Plasmid#50920PurposeU6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA Ser promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only