32,967 results
-
Plasmid#162778PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to one tyrosine sulfation (TS) motif. LaM4-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a TS site, T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialPromoterT7Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn5-163
Plasmid#118542PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertsYFP2
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_10xHisTEVATG5_ATG12
Plasmid#190861PurposePlasmid for the expression of ATG5 and ATG12 protein subunit complexes. Internal References: SMC1178DepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
ReactionC_pBIG1a_ATG7_ATG10
Plasmid#190860PurposePlasmid for the expression and purification of ATG7 and ATG10 protein subunit complexes. Internal reference: SMC1179DepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA789
Plasmid#186244Purposesoc-F HR Donor Vector (T4 phage editing)DepositorInsertBBR1 backbone + T4 phage homology
ExpressionBacterialAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDR111_Bgal NLS
Plasmid#188396PurposeExpresses beta-galactosidase via Phyper-spank which is optimized for Bacillus subtilis. There is a secretion peptide (PhoD) and nuclear localization signal (SV40) that is fused to beta-galactosidase.DepositorInsertlacZ
TagsPhoD secretion peptide and SV40 NLSExpressionBacterialPromoterPhyper spankAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBK.134
Plasmid#187219PurposeExpresses Eco1 ncRNA v35 (long a1/a2) and Eco1 ncRNA v35 (long a1/a2, barcode 6) from promoters pTet* and pBetI, respectivelyDepositorInsertA: Retron Eco1 ncRNA v35 (long a1/a2); B: Retron Eco1 ncRNA v35 (long a1/a2, barcode 6)
UseSynthetic BiologyExpressionBacterialPromoterA: pTet*; B: pBetIAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSelect-6
Plasmid#190243PurposeEncodes lacI- and GFP-targeting gRNAs for positive and negative selections of dCas9 activity.DepositorInsertLacI
ExpressionBacterialAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-chi28TAG
Plasmid#188984PurposeExpress chimadanin with TAG at 28 positionDepositorInsertChimadanin with TAG at 28 position
ExpressionBacterialAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCSGC-GB1
Plasmid#186786PurposeE. coli expression vector containing N-terminal 6His-GB1-TEV fusion.DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB167
Plasmid#101672PurposeOpto-T7RNAP*(563), equal expr.DepositorInsertOpto-T7RNAP*(563), equal expr.
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB152
Plasmid#101663PurposeOpto-T7RNAP*(563-F2)DepositorInsertOpto-T7RNAP*(563-F2)
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB147
Plasmid#101662PurposeOpto-T7RNAP*(302)DepositorInsertOpto-T7RNAP*(302)
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB164
Plasmid#101667PurposeOpto-T7RNAP*(563), half expr.DepositorInsertOpto-T7RNAP*(563), half expr.
UseSynthetic BiologyExpressionBacterialAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA03
Plasmid#172194PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattR
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE80_T5_P9-ehaA_LacI
Plasmid#186317PurposePlasmid for inducible E coli expression of the P9 helixCAM.DepositorInsertP9-ehaA
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD_mCherry_GFP_-+
Plasmid#187390Purposearabinose-inducible expression of GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD_GFP_mCherry_++
Plasmid#187391Purposearabinose-inducible expression of GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only