We narrowed to 105 results for: Folding Reporter GFP
-
Plasmid#183514PurposeThe plasmid contains LIC cassette upstream of folding reporter GFP and TEV-cleavable 10x histidine purification tag. Compatible with T7 promoter-based expression system in E. coliDepositorTypeEmpty backboneTags10x His-tag and folding reporter GFPExpressionBacterialPromoterT7 lacAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pYUBcLIC-GFP
Plasmid#183509PurposeThe plasmid contains LIC cassette upstream of folding reporter GFP and TEV-cleavable 10x histidine purification tag. Compatible with T7 promoter-based expression system in mycobacteria.DepositorTypeEmpty backboneTags10x His-tag and folding reporter GFPExpressionBacterialPromoterT7 lacAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIVEX2.3-AC17-5c-frGFP
Plasmid#217525PurposeAC17-5c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.DepositorInsertAC17-5c riboswitch-regulated folding reporter GFP
UseIn vitro transcription-translationPromoterT7Available SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP
Plasmid#64904Purpose"Fluorescent reporter containing no disulfide bonds/Selenocystamine folding"DepositorInsertGreen fluorescent protein
UsePsba chlamydomonas reinhardtii vectorPromoterpsbAAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-R-bpA-3xSV40pA-R-td-sfGFP
Plasmid#133579PurposeCAG tdGFP dre/rox reporter piggyBac transposon (bpA 3x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseDre/roxExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-NoMi-P2A-CopGFP-T2A-PuroR
Plasmid#207805PurposeE-NoMi is a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins under an EF-1α promoter.DepositorInsertE-NoMi
UseLentiviralTags3xFlag tag, copGFP, mCherry, and nanoluciferaseExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AB-GFP
Plasmid#72203Purposescreen AB42 variants for aggregationDepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-tagBFP-PSM-EGFP
Plasmid#100603PurposeDonor scaffold with EGFP positive selection module, and tagBFP negative selection moduleDepositorTypeEmpty backboneUseSynthetic BiologyTagsEGFP-T2A-Puro and tagBFPAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5080_pHR_PGK_sfGFP_CoV-F2
Plasmid#155304PurposeSARS-CoV-2 fluorescent reporter 2DepositorUseLentiviralExpressionMammalianPromoterPGKAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MCS-P2A-sfGFP
Plasmid#74668PurposePlasmid for expression of wild-type or mutant cDNA fragments (mutation reporter) or complete cDNAs in frame with superfolderGFP.DepositorInsertsfGFP
ExpressionMammalianAvailable SinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTR47m4-GFP
Plasmid#102436PurposeFormaldehyde biosensor plasmid with sGFP reporter and modified frm promoterDepositorInsertsFormaldehyde repressor protein (frmR)
Superfolder GFP
UseSynthetic BiologyExpressionBacterialAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-3xSV40pA-L-td-sfGFP
Plasmid#133574PurposeCAG tdGFP cre/lox reporter piggyBac transposon (3x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseCre/LoxExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-3xSV40pA-F-td-sfGFP
Plasmid#133570PurposeCAG tdGFP FLP/FRT reporter piggyBac transposon (3x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseFlp/frtExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-bpA-F-L-td-sfGFP
Plasmid#133580PurposeCAG tdGFP FLP/FRT reporter piggyBac transposon (bpA stop)DepositorInsertTandem dimer superfolder GFP
UseFlp/frtExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-R-3xSV40pA-R-td-sfGFP
Plasmid#177150PurposeCAG tdGFP dre/rox reporter piggyBac transposon (3x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseDre / rox ; piggybacExpressionMammalianPromoterCAGAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-msfGFPΔN12
Plasmid#231550PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-bpA-3xSV40pA-F-td-sfGFP
Plasmid#133573PurposeCAG tdGFP FLP/FRT reporter piggyBac transposon (bpA 3x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseFlp/frtExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-3xSV40pA-L-td-sfGFP
Plasmid#133577PurposeCAG tdGFP cre/lox reporter piggyBac transposon (bpA 3x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseCre/LoxExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-bpA-2xSV40pA-F-td-sfGFP
Plasmid#133572PurposeCAG tdGFP FLP/FRT reporter piggyBac transposon (bpA 2x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseFlp/frtExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-td-sfGFP
Plasmid#133576PurposeCAG tdGFP cre/lox reporter piggyBac transposon (bpA 2x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseCre/LoxExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-SV40pA-L-td-sfGFP
Plasmid#133575PurposeCAG tdGFP cre/lox reporter piggyBac transposon (bpA 1x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseCre/LoxExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-R-bpA-2xSV40pA-R-td-sfGFP
Plasmid#133578PurposeCAG tdGFP dre/rox reporter piggyBac transposon (bpA 2x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseDre/roxExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-bpA-SV40pA-F-td-sfGFP
Plasmid#133571PurposeCAG tdGFP FLP/FRT reporter piggyBac transposon (bpA 1x SV40pA stop)DepositorInsertTandem dimer superfolder GFP
UseFlp/frtExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC9-LifeactΔN2
Plasmid#231556PurposeMammalian expression of N-terminally truncated Lifeact fused to C-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
iGFP-gamma-actin
Plasmid#231554PurposeMammalian expression of human gamma actin fused intramolecularly to monomeric superfolder GFPDepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc LifeactΔC4-msfGFPΔN7
Plasmid#231555PurposeMammalian expression of C-terminally truncated Lifeact fused to N-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
iGFP-beta-actin
Plasmid#231553PurposeMammalian expression of human beta actin fused intramolecularly to monomeric superfolder GFPDepositorAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTS-hFluc-HA-GFP11
Plasmid#177726PurposeFirefly luciferase reporter fused to a mitochondria signal sequence for mitochondrial targeting with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, and Mitochondrial Targeting SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-eGFP-KDEL
Plasmid#177727PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFluc
TagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-eGFP-KDEL
Plasmid#177728PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention and fused to eGFP at the C-terminusDepositorInserthFlucDM
TagsKDEL, Prolactin Signal Sequence, and eGFPExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-HA-GFP11-KDEL
Plasmid#177722PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-HA-GFP11-KDEL
Plasmid#177723PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFlucDM
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-beta-actin
Plasmid#231548PurposeMammalian expression of human beta actin fused to C-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP11-Ura
Plasmid#177731PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminus in yeast plasmid withDepositorInsertFlucDM
TagsGFP11, HA, HDEL, and KAR2 Signal SequenceExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP- Ura
Plasmid#177732PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention and fused to eGFP at the C-terminus in yeast plasmid with URA markerDepositorInsertFlucDM
TagsHA, HDEL, KAR2 Signal Sequence, and eGFPExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJBL7368
Plasmid#217375PurposesfGFP reporter for Bce crcB fluoride riboswitchDepositorInsertBce crcB riboswitch sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL6951
Plasmid#217373PurposesfGFP reporter for Bsu pbuE* 2AP riboswitchDepositorInsertPca rhtB riboswitch sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL730
Plasmid#217374PurposesfGFP reporter for Bsu yxjA 2AP riboswitchDepositorInsertyxjA riboswitch sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL6931
Plasmid#217369PurposesfGFP reporter for WT Pca rhtB ZTP riboswitchDepositorInsertPca rhtB riboswitch sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-RFPnls-PQRv2-mCD8:GFP
Plasmid#73974PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in insect cells.DepositorInsertssfGFP
RFP
TagsmCD8 and nlsExpressionInsectPromoter20XUAS-HSAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL7346
Plasmid#217370PurposesfGFP reporter for synthetic transcriptional variant of Pca rhtB ZTP riboswitchDepositorInsertPca rhtB synthetic transcriptional riboswitch sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapERK)d1EGFP (KroxDs)
Plasmid#214912Purposefor PiggyBac mediated integration and stable expression of destabilised EGFP as a reporter to MAPK/ERK pathway activationDepositorInsertd1EGFP under the MapERK promoter
ExpressionMammalianPromoterMapkERK promoterAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xUPRE-minP-EGFP
Plasmid#159668PurposeEGFP reporter plasmid containing 25 tandem repeats of the the unfolded protein response element (UPRE)DepositorInsert25xUPRE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
TagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only