We narrowed to 167 results for: SHH
-
Plasmid#31233DepositorAvailable SinceAug. 23, 2012AvailabilityAcademic Institutions and Nonprofits only
-
shh10
Plasmid#64867PurposeThis plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the engineered shh10 capsid protein.DepositorInsertshh10 cap
UseAAVMutationI319V, N451D, D532NAvailable SinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX_sgRNA_entry (CJT32)
Plasmid#181782PurposeExpresses ShHELIX containing a nicking I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 ShhN
Plasmid#37680DepositorAvailable SinceJuly 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOEM1_pCMV:hShh-pPH:vsvged
Plasmid#111156PurposeBaculovirus rescue vector, VSVGED pseudotype, hShhDepositorInserthShh (SHH Human)
UseBaculoviral rescue shuttle vectorExpressionInsect and MammalianMutationwtPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
shha-pCRII
Plasmid#68962Purposefor antisense probe, NotI w/ Sp6DepositorInsertshha (shha Zebrafish)
Available SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga1#3
Plasmid#122289PurposeKnockdown for mouse Hmga1DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga1#1
Plasmid#122288PurposeKnockdown for mouse Hmga1DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#3
Plasmid#122291PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH1
Plasmid#241994PurposeSleeping Beauty vector for inducible expression of a chicken H1 targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH1
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH3
Plasmid#241995PurposeSleeping Beauty vector for inducible expression of a chicken H3 targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH3
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2B
Plasmid#241996PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2A
Plasmid#241997PurposeSleeping Beauty vector for inducible expression of a chicken H2A targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2A
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-1-shH2B
Plasmid#240417PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianPromoterTREAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH4
Plasmid#240431PurposeSleeping Beauty vector for inducible expression of a chicken H4 targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH4
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSico-shHDAC2
Plasmid#194983Purposeconditional knock down HDAC2DepositorInsertshHDAC2
ExpressionBacterialAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22i2Shh24G4FER3(#1041)
Plasmid#184072Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-Shha2.4Available SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only