We narrowed to 4,639 results for: crispr c plasmids
-
Plasmid#112340PurposeCRISPR donor plasmid to tag human transcription factor ZNF589 with GFPDepositorInsertZNF589 homology arms flanking EGFP-IRES-Neo cassette (ZNF589 Human)
UseCRISPRTagsExpressionMutationhg38:3:48267877:T>C, hg38:3:48267890:C>T, h…PromoterAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZNF445-donor
Plasmid#112332PurposeCRISPR donor plasmid to tag human transcription factor ZNF445 with GFPDepositorInsertZNF445 homology arms flanking EGFP-IRES-Neo cassette (ZNF445 Human)
UseCRISPRTagsExpressionMutationrs78585428, hg38:3:44446218:C>T, hg38:3:444466…PromoterAvailable sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB07
Plasmid#190481PurposeTargeting plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsUpstream & Downstream pyrE deletion region
gRNA
UseE. coli / b. subtilis - c. difficile shuttle vect…TagsExpressionMutationPromoterAvailable sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-ABE C-terminal
Plasmid#137178PurposeAAV genome: expresses the C-terminal of v5 AAV-ABE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE C-terminal; U6-protospacer
UseAAVTagsExpressionMutationPromoterCMVAvailable sinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVTagsExpressionMutationE782K;N968K;R1015H conferring recognition of NNNR…PromoterCbhAvailable sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVTagsExpressionMutationPromoterCbhAvailable sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT_PCaspase-N-C-term
Plasmid#214046PurposeBacterial expression plasmid for SAVED-CHAT, PCaspase N-terminal fragment (aa 1-153), and C-terminal fragment (154-666) from Haliangium ochraceumDepositorInsertSAVED-CHAT-PCaspase
UseTagsExpressionBacterialMutationaa 1-153, 154-666PromoterlacUV5 promoterAvailable sinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVEZF1-donor
Plasmid#112341PurposeCRISPR donor plasmid to tag human transcription factor VEZF1 with GFPDepositorInsertVEZF1 homology arms flanking EGFP-IRES-Neo cassette (VEZF1 Human)
UseCRISPRTagsExpressionMutationrs999907002, hg38:17:57975308:A>T, hg38:17:579…PromoterAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-2-RPB1-C-term
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZNF250-donor
Plasmid#112383PurposeCRISPR donor plasmid to tag human transcription factor ZNF250 with GFPDepositorInsertZNF250 homology arms flanking EGFP-IRES-Neo cassette (ZNF250 Human)
UseCRISPRTagsExpressionMutationhg38:8:144882271:C>G,hg38:8:144882273:T>CPromoterAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJB06
Plasmid#190480PurposeBase Cas9 expression plasmid for 2-plasmid C. difficile mutagenesis systemDepositorInsertsCas9
XylR
UseE. coli / b. subtilis - c. difficile shuttle vect…TagsExpressionMutationPromoterxylR-driven promoterAvailable sinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorInsertTHRB (THRB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only