-
Plasmid#189989PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hCRY2, works with Addgene 189983-189986DepositorInsertCryptochrome-2 (CRY2 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-BSD
Plasmid#174819PurposeMammalian expression of SpCas9 prime editor 2 with P2A-BSD markerDepositorInsertPE2-P2A-BSD
UseTagsP2A-BSD and SV40 bpNLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ATF4
Plasmid#192911PurposeBarcoded piggybac transposon vector with Dox-inducible expression of ATF4DepositorInsertATF4 (ATF4 Human)
UseTagsHAExpressionMammalianMutationPromoterTET3G-miniCMVAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(280-342)
Plasmid#72550Purposeexpresses 3*FLAG tagged human NSD3-short with 280-342 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutation280-342 aa deletionPromoterLTRAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(384-645)
Plasmid#72549Purposeexpresses 3*FLAG tagged human NSD3-short with 384-645 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutation384-645 aa deletionPromoterLTRAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(100-263)
Plasmid#72548Purposeexpresses 3*FLAG tagged human NSD3-short with 100-263 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3xFlag and SV40 NLSExpressionMammalianMutation100-263 aa deletionPromoterLTRAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET22b-GST-6P2-LTLT-KIF1C(642–922)-GFP-6His
Plasmid#222288PurposeExpression of KIF1C stalk with N-terminal GST (cleavable) and C-terminal GFP and His tag in E.coli for purification.DepositorInsertKIF1C (KIF1C Human)
UseTags6xHis, GFP, and GSTExpressionBacterialMutationstalk region only amino acids 642 to 922PromoterT7Available sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET22b-GST-6P2-LTLT-KIF1C(642–922)-6His
Plasmid#222289PurposeExpression of KIF1C stalk with N-terminal GST (cleavable) and C-terminal 6xHis tag in E.coli for purification.DepositorInsertKIF1C (KIF1C Human)
UseTags6His and GSTExpressionBacterialMutationstalk region only amino acids 642 to 922PromoterT7Available sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVtet2_bGHpA
Plasmid#177358PurposeAAV expression of scFV-fused catalytic domain of TET2 from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterTetracycline-dependent promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNLF1-C_PLCG1:1-1291
Plasmid#211089PurposeMammalian expression of full-length human PLCG1 isoform 2. C-terminal NanoLuc luciferase tag.DepositorInsertPLCG1:M1-L1291 (PLCG1 Human)
UseTagsNanoLuc luciferaseExpressionMammalianMutationisoform 2. I813T natural variant (VAR_011908)PromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIS2-hsSTAM1 (1-143)
Plasmid#21498DepositorInsertphis2- STAM1(1-143) (STAM Human)
UseTags6x HisExpressionBacterialMutationnonePromoterAvailable sinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
TOPO CloverCP
Plasmid#68444PurposeTOPO construct expressing CloverCP for generation of GMAP-compatible geneDepositorInsertCloverCP
UseGmapTags"CP" degradation domainExpressionBacterialMutationPromoterPlacAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJJB1357
Plasmid#218595PurposeExpress Pex11 and the degron assay: Degradation tag-YFP-ePTS1DepositorInsertPex11
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-hGtACR2-EYFP
Plasmid#67877PurposeMammalian expression construct of human codon-adapted anion channelrhodopsin 2 from Guillardia theta fused in frame to EYFP via a NotI site in the pFUGW vector backboneDepositorInserthGtACR2
UseLentiviralTagsEYFPExpressionMammalianMutationPromoterUbCAvailable sinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only