We narrowed to 11,444 results for: nar;
-
Plasmid#18038DepositorInsertPaired (prd Fly)
ExpressionBacterialMutationPaired is simply used as an insert between Kpn1 a…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLSHiFiNG-P2A-Puro
Plasmid#136903PurposeLentivirus for constitutive expression of FNLSHiFiNG in mammalian cells (codon optimized)DepositorInsertFNLSHiFiNG
UseLentiviralTagsFLAG-NLS and NLSMutationR691A,L1111R,D1135V,G1218R,E1219F,A1322R,R1335V,T…PromoterEF1sAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB1H2wL-Prd
Plasmid#18040DepositorInsertPaired (prd Fly)
ExpressionBacterialMutationPaired is simply used as an insert between Kpn1 a…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NGFP-mAID
Plasmid#140607PurposeExpression of OsTIR1 and GFP-mAID protein in mammalian cells under the control of EF1a promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
rs214-minor
Plasmid#113380Purposeevaluate FOXA1 DIV motif enhancer activity in SNP rs2149943 minor allele (T)DepositorInsertrs2149943 minor allele
UseLuciferaseAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
lvl0-G-Gal4-VPR
Plasmid#229187Purposelvl 0 5 geneDepositorInsertGal4-VPR
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
IZ501: pMVP/Lenti-DEST
Plasmid#121848PurposepMVP destination vector, empty Lentivirus vector backboneDepositorTypeEmpty backboneUseLentiviral; Pmvp gateway destination vectorAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLC-238
Plasmid#73192PurposeTemplate plasmid which encodes kanamycin resistance gene for positive selection and toxin gene (chpB) under the control of rhamnose induceable promoter (PrhaB) for negative selection.DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB1H2w2-mutOdd
Plasmid#18044DepositorInsertmutant Odd Skipped
ExpressionBacterialMutationA mutant version of the zinc finger protein Odd S…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmCherry-mAID
Plasmid#140603PurposeExpression of OsTIR1 and mCherry-mAID protein in mammalian cells under the control of EF1a promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAluYNF1
Plasmid#50933PurposeExpresses dimeric AluY RNA in mammalian cells.DepositorInsertAluYNF1
ExpressionMammalianPromoter7SL RNA promoter (pol III)Available SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-CMV-NmCherry-mAID
Plasmid#140601PurposeExpression of OsTIR1 and mCherry-mAID protein in DT40 cells under the control of CMV promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-B4E
Plasmid#162067PurposeFor expresion of the B4E fusion protein, consists of the ampR gene (encoding the enzyme β-lactamase without the native signal sequence) fused to residues 28-215 of the murine eIF4EDepositorInsertampR-eIF4E fusion protein
Tags6xHis tagExpressionBacterialMutationeIF4E incorporating the K119A mutation, which is …PromoterT7Available SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEM-sgMUC1_dual-MTS-3x-Set I
Plasmid#162763PurposeSeparately expressing 3 unique sgMUC1_dual-MTS (SetI)DepositorInsertsgMUC1_dual-MTS_1; sgMUC1_dual-MTS_2; sgMUC1_dual-MTS_3
ExpressionMammalianPromoterU6Available SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLC-241
Plasmid#73194PurposeTemplate plasmid which encodes kanamycin resistance gene for positive selection and toxin gene (mqsR) under the control of rhamnose induceable promoter (PrhaB) for negative selection.DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
IQ013: pMVP/Ad-DEST
Plasmid#121843PurposepMVP destination vector, empty adenovirus vector backboneDepositorTypeEmpty backboneUseAdenoviral; Pmvp gateway destination vectorAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
jk56
Plasmid#87009Purposegenomic Sindbis virus plasmid for expression of SYNseq componentsDepositorInsertsNrx1B
mCherry
UseSynthetic Biology; Sindbis virus genomic plasmidExpressionMammalianAvailable SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-RNMT
Plasmid#112709PurposeExpresses N-terminally GST-tagged human RNMT in bacterial cellsDepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTmpKmA1O4in
Plasmid#176232PurposeA template plasmid for amplification of the cI-hok-neo cassette, which contains A1O4 promoter. The promoter is directed toward the cI gene.DepositorInsertcI of phage lambda, hok of the R1 plasmid, neo, hybrid PA1O4 promoter
UseSynthetic BiologyExpressionBacterialAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only