169,371 results
-
Plasmid#46536PurposeA lentiviral vector for the expression of mouse Sox10 under doxycyline control.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pK170.AAV-TRE-Cre-WPRE (Supernova)
Plasmid#85040PurposeFor AAV-TRE-Cre based Supernova, pK170 should be used with pK168 etc.DepositorInsertnlsCre-WPRE
UseAAVExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFOS WT-GL3
Plasmid#11983PurposeReporter gene with mouse c-fos promoter. Induced by serum and many growth factors in quiescent cells.DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEP4 E02S ET2K
Plasmid#20927Purposeused in the derivation of human iPS cells using non-integrating episomal vectors; expresses Oct4 and Sox2; SV40LT and Klf4DepositorArticleAvailable SinceMay 20, 2009AvailabilityAcademic Institutions and Nonprofits only -
GFP-TPD54
Plasmid#172448PurposeExpression of Tumor Protein D52 like 2 (TPD54/TPD52L2) with N-terminal GFP tagDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR V7
Plasmid#86856PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)DepositorInsertAndrogen receptor (AR) (AR Human)
TagsEGFPExpressionMammalianMutationAlternative splice variant 7 (alteration/deletion…PromoterCMVAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIA586
Plasmid#104399Purposevector for expression of single E.coli RNAP subunitDepositorInsertrpoD
TagsHis6ExpressionBacterialPromoterT7Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCyterm-mScarlet3_N1
Plasmid#189778PurposeConstruct for testing oligimerization of mScarlet3 in mammalian cells by OSER assayDepositorInsertCyterm-mScarlet3
ExpressionMammalianPromoterCMVAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
NG-ABEmax
Plasmid#124163PurposeA-to-G base editorDepositorInsertTadA-TadA(evo)-Cas9-NG
ExpressionMammalianAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only