We narrowed to 2,167 results for: CO
-
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
MK01_HUMAN_D0
Plasmid#79713PurposeThis plasmid encodes the kinase domain of MK01. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_1k)-PGKpuro2ABFP-W
Plasmid#208416PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_2b)-PGKpuro2ABFP-W
Plasmid#208417PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_on-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233373PurposeEF1α driven co-expression of the consitutively active kinase activity recorder positive control Kinprola_on fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_on-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_PKA_T/A-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233372PurposeEF1α driven co-expression of the inactive PKA activity recorder negative control with T/A mutation Kinprola_PKA_T/A fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_PKA_T/A-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220609PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook3_FTS_FHIP1B
Plasmid#222299PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK3 and FHIP1B) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionBacterialAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook2_FTS_FHIP2A
Plasmid#222302PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK2 and FHIP2A) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST-AUP1 379-410:Ube2G2
Plasmid#185335PurposeUsed for co-expression of the AUP1 G2BR with UBE2G2 for crystallographyDepositorAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCHAT)-PGKpuro2ABFP-W
Plasmid#163147PurposeLentiviral gRNA plasmid targeting human CHAT gene, co-expression of BFP tagDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2ABFP-W
Plasmid#163174PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i1-i5-TEV-Strep
Plasmid#180314Purposebacterial co-expression of human SEPT7 and of human SEPT9_i1-i5DepositorTagsTEV-StrepExpressionBacterialMutationSEPT9_i1-i5Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-DS-HDAC5_HDAC3)
Plasmid#114399PurposeFor PYL-HDAC5 catalytic domain swap to HDAC3 catalytic domain expressionDepositorTags3xFlag-NLS (internal)ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2ABFP-W
Plasmid#163170PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W
Plasmid#163172PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway cloning vectorAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only